VC280 |
C. elegans |
air-2(ok298)/okIs59 I. Show Description
okIs59 [myo-2::GFP + pes-10::GFP + F22B7.9::GFP] I. B0207.4. Heterozygote has wild-type gross phenotype, with semi-dominant GFP expression in pharynx. Segregates WT dim GFP, WT bright GFP (okIs59 homozygotes) and non-GFP sterile Unc (air-2 homozygotes). Pick dim GFP WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2200 |
C. elegans |
gst-24(ok2980) II. Show Description
F37B1.1 Homozygous. Outer Left Sequence: gcgacgattcatggtctttt. Outer Right Sequence: ctctccctcccctcaatttc. Inner Left Sequence: caaactccccaggtgtgact. Inner Right Sequence: ggagattttcgaaacgactttg. Inner Primer PCR Length: 1156. Deletion size: about 600 bp. ttggtcagctcccattcctc [ 603 bp deletion] caagttatctaggcacgagg -- Wild type ttggtcagctcccattcctc ------------------ caagttatctaggcacgagg -- ok2980 Sequence shown is on the minus strand. Deletion starts in the second exon and removes the downstream part of that exon, the 3'-UTR, and approximately 0.1 kb of downstream flanking sequence. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2201 |
C. elegans |
M60.6(ok2981) X. Show Description
M60.6 Homozygous. Outer Left Sequence: cacgtacgaaaccccaaagt. Outer Right Sequence: agttgcacaatccttttcgc. Inner Left Sequence: ttctcctgagaaagaatttggttt. Inner Right Sequence: gttatcggaaacaacgacgg. Inner Primer PCR Length: 1302. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2202 |
C. elegans |
vit-4(ok2982) X. Show Description
F59D8.2 Homozygous. Outer Left Sequence: cagcgtgagcattttgagaa. Outer Right Sequence: caaagctgaggtcaacccat. Inner Left Sequence: cgaagacggtttcgaatgat. Inner Right Sequence: tcaaggctatcgagatagagca. Inner Primer PCR Length: 1165. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2203 |
C. elegans |
F01G12.6(ok2983) X. Show Description
F01G12.6 Homozygous. Outer Left Sequence: ttgggacgagaaaatgaagg. Outer Right Sequence: ccaagttgagggtctcggta. Inner Left Sequence: ttgtgcatgggagaagttga. Inner Right Sequence: tgcaacattcataaaaatgcaa. Inner Primer PCR Length: 1279. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2204 |
C. elegans |
W10G6.1(ok2984) X. Show Description
W10G6.1 Homozygous. Outer Left Sequence: tgcatgcaactggaaacatt. Outer Right Sequence: ttatcacgtcggaagaggct. Inner Left Sequence: tgtgaatcagcagaaatgtcaa. Inner Right Sequence: accttcaactgcaggacgat. Inner Primer PCR Length: 1190. Deletion size: about 600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2205 |
C. elegans |
hex-2(ok2985) V. Show Description
C14C11.3 Homozygous. Outer Left Sequence: acactcggttttcggctatg. Outer Right Sequence: tttcccaccaagcacctaac. Inner Left Sequence: atttccagaatccttgcgtg. Inner Right Sequence: agcgcatttttctgcatctc. Inner Primer PCR Length: 1120. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2206 |
C. elegans |
T25D3.3(ok2986) II. Show Description
T25D3.3 Homozygous. Outer Left Sequence: caaaattggagccaaaggaa. Outer Right Sequence: tctcgaacgtcttcgtgatg. Inner Left Sequence: gacccgagagcgtgatttta. Inner Right Sequence: ttggtgacaaaatgttcgga. Inner Primer PCR Length: 1186. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB2207 |
C. elegans |
K08F8.1(ok2987) II. Show Description
K08F8.1 Homozygous. Outer Left Sequence: cagaatcacgccatgagcta. Outer Right Sequence: tcgtgtgggaacgcataata. Inner Left Sequence: tggtgattgggggttaagaa. Inner Right Sequence: agcgacacctttcatcgagt. Inner Primer PCR Length: 1298. Deletion size: about 800 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
VC2301 |
C. elegans |
ptr-6(ok2988) II. Show Description
C54A12.1. External left primer: AAAATGATGTTCCTTTGCCG. External right primer: GCTCTTGTGGTTCGGAATGT. Internal left primer: CAAGAGCTGAAATTTTGAATAGGA. Internal right primer: ACACTCATCGCTCCGTTCTT. Internal WT amplicon: 1379 bp. Deletion size: 493 bp. Deletion left flank: TCTCTGAAATGATGGAAATGTAAAAAGGTA. Deletion right flank: CAAAGAAGGTGATTTGATAAAGGAATGTGA. Insertion Sequence: CAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|