More Fields
Strain Species Genotype
VC1086 C. elegans D2013(ok227) II. Show Description
D2013. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1766 C. elegans C12D8.1(ok2270) V. Show Description
C12D8.1 Homozygous. Outer Left Sequence: aaagaagttgtggtgccgac. Outer Right Sequence: aatggaaggatttaacccgc. Inner Left Sequence: ccgttagccgaaaaattgaa. Inner Right Sequence: cgaatacttgtttgaacccca. Inner Primer PCR Length: 3085. Deletion size: about 2700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1767 C. elegans clec-39(ok2271) V. Show Description
T25E12.7. Homozygous. Outer Left Sequence: TGGCTGCCTTGCTAGAAAAT. Outer Right Sequence: GTTATTGCACGGGAGACGTT. Inner Left Sequence: GACATTCACACAATCACCGC. Inner Right Sequence: GGGAAAGTGCTCAACTACCG. Inner Primer PCR Length: 2219 bp. Deletion Size: 1334 bp. Deletion left flank: GGTGCCACTCTTTTTTCCATAAAAAGTGAA. Deletion right flank: AATTTTAGAAATTAAAAAAAAAATCACATA. Insertion Sequence: AAATTTTAGAAATTAAAAAAAATTTTAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1768 C. elegans T07D1.3(ok2272) X. Show Description
T07D1.3. Homozygous. Outer Left Sequence: AATGACACGTGCGACCATTA. Outer Right Sequence: AAAAATGCGGTTTCGTGTTC. Inner Left Sequence: CTTCGGAATATTTGCCTCCA. Inner Right Sequence: AAAAAGTGCCAACAACTGGC. Inner Primer PCR Length: 2130 bp. Deletion Size: 1260 bp. Deletion left flank: TTGGATTAAATGAAGAAATGCTTTTGTTAA. Deletion right flank: TGCATATTTTGGTGGTTTATCTAGTGTTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1769 C. elegans mig-2(ok2273) X. Show Description
C35C5.4. Homozygous. Outer Left Sequence: CCGAGGTTTTCGTTTTTCAA. Outer Right Sequence: AATGACTGGGAAACGTCCAA. Inner Left Sequence: TTTTGTTCCACGCTTTGTCA. Inner Right Sequence: ATGATCGGGAAGAAGAGCCT. Inner Primer PCR Length: 2116 bp. Deletion Size: 1192 bp. Deletion left flank: ATTTTCGCCAACTTTTCATTCCCTAACTTT. Deletion right flank: TTTTGTTGAAACTCATAAAACTATATCTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1770 C. elegans nac-3(ok2274) III. Show Description
K08E5.2. Homozygous. Outer Left Sequence: AACAAATGGGTGAGGGATCA. Outer Right Sequence: ATTCCCTCAGAGCCCAATTT. Inner Left Sequence: GGGAACTGTAAAGGGTGATCG. Inner Right Sequence: AAAACTGACGCTTTTCACCG. Inner Primer PCR Length: 3136 bp. Deletion Size: 1560 bp. Deletion left flank: ATTTAAACACTATAGCAGTTTCCAAAACTC. Deletion right flank: GAGAAATCTTTGAATTCTCTGAGAAACTTT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1771 C. elegans Y52D3.1(ok2275) III. Show Description
Y52D3.1 Homozygous. Outer Left Sequence: cagtgtgttcgcctaaccct. Outer Right Sequence: aatcgataacgggaacatgc. Inner Left Sequence: atcaatgagaaatcggctgc. Inner Right Sequence: gaggaggacgagtcgttgag. Inner Primer PCR Length: 2513. Deletion size: about 1900 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1772 C. elegans K08B12.2(ok2276) V. Show Description
K08B12.2. Homozygous. Outer Left Sequence: TCCTTTTTGTCGTTGCATTG. Outer Right Sequence: GGAGTGAACCCGATCTTGAA. Inner Left Sequence: CGTTTGTCGTTGTTGCATCT. Inner Right Sequence: GCAAGAAGAAAATGGGTGGA. Inner Primer PCR Length: 2599 bp. Deletion Size: 914 bp. Deletion left flank: GAGCGGAATGGAATGAAGAGTGTGTGTGTG. Deletion right flank: ATGTCAATGAGAGCTAACGCCATCATCAGA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1780 C. elegans vps-28(ok2278)/hIn1 [unc-101(sy241)] I. Show Description
Y87G2A.10. Apparent homozygous lethal deletion chromosome balanced by unc-101-marked inversion. Heterozygotes are WT, and segregate WT, Unc-101 hIn1 homozygotes, and ok2278 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AAAGACGTTGTGTCTTCCCG. External right primer: CTACAAACCGAGCTGAGCCT. Internal left primer: CCTCACAATTTTGAAACTGCTC. Internal right primer: AATTTCGAGTTTTCGCTTGAA. Internal WT amplicon: 3080 bp. Deletion size: approximately 1600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1796 C. elegans ZK1127.5&ZK1127.12(ok2279)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK1127.5, ZK1127.12. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2279 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATATGTTGCAAAGGACCGC. External right primer: CTCAGCACCTTCCAATCCTC. Internal left primer: TGAATTCTCACAATGGAGCG. Internal right primer: AAATCTGAGCCGGTCCTGTA. Internal WT amplicon: 3074 bp. Deletion size: 1999 bp. Deletion left flank: TTTAGTTTCTATTTGAGCTCAATCCTCAAA. Deletion right flank: ATCTACGGTAACAGTGTCCGATCTACGGTA. Insertion Sequence: GGAAGTGTGAAACATCTTTAGGACAGAGTGTCATAAATGTGCTTGCAAGTATTTGAGCA CTACTGTCAAGGGCACCTCCCATGTAAATTTGTTGAAGAAGAGCATGACCGGCTTCAAT TCCAATGTCTTCTGGAAGAATTGGAACTCCTGATTCGCCCTTCGGTCTTGAAATAGCTT CTGCTTGGTAGATAACACCCTCTGTCGTTTCGGCGGTTAAGAACAGACCATATCCTGGA GAAGCGCCACCAGCATCACCTTTCCGTTGATCAACAGTAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1797 C. elegans sft-1(ok2277)/sC1 [dpy-1(s2170)] III. Show Description
H06I04.2. Apparent homozygous lethal deletion chromosome balanced by dpy-1-marked recombination suppressor. Heterozygotes are WT, and segregate WT, Dpy (sC1 homozygotes), and ok2277 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: AGACAACTCCTTGCCTCACC. External right primer: ATTCCCCGCCATTTATTACC. Internal left primer: CAAACAATCCCAAATTCTCG. Internal right primer: AGCTACAGTAACCCGCGAAA. Internal WT amplicon: 3080 bp. Deletion size: 1808 bp. Deletion left flank: AAAAAAAATTTCTAAATTTATTCCCAATTT. Deletion right flank: TCAAAAAATCAGGGGTTCGTTGTGAAAAAT. Insertion Sequence: TCTTCTAAATTTATTCCCAATTTCTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807