Amplify with the following external primers: EL1(agtcctgaacggagctttga); ER1(tacaatggcagcagcaagtc). Then re-amplify with the nested primer set: IL1(tcgcacattggtttgttgtt); IR1(aacggcatgagttagccaat).

K07B1.3. Homozygous. Outer Left Sequence: AGTCCTGAACGGAGCTTTGA. Outer Right Sequence: TACAATGGCAGCAGCAAGTC. Inner Left Sequence: TCGCACATTGGTTTGTTGTT. Inner Right Sequence: AACGGCATGAGTTAGCCAAT. Inner primer WT PCR product: 2995. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes are WT and GFP+. ok1954 homozygotes arrest as larvae. Pick GFP+ heterozygotes to maintain. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal. Reference: Rodenas E, et al. Mol Biol Cell. 2012 Mar;23(5):930-44.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

C25F6.4. Homozygous. Outer Left Sequence: CACAACAACCCCTGTCATCA. Outer Right Sequence: GTTTCTCACCGCATTTGGTT. Inner Left Sequence: AAGAACTGTGTGCATGCGAG. Inner Right Sequence: GTTGAGCATGATGTGATGGC. Inner Primer PCR Length: 3271 bp. Deletion Size: 1681 bp. Deletion left flank: AGATGGTCGCATCACGATATTGTTCGAGTT. Deletion right flank: GGTACACGAGCTCTGGGAGATGAGATAGCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C45E1.1. Homozygous. Outer Left Sequence: AAATTCGTGTCGAAAATGCC. Outer Right Sequence: GTGGACGGTGTGATCACTTG. Inner Left Sequence: GGGATAGAATTCGACCAGCA. Inner Right Sequence: ATCGTTGCATTTAAGGTGGC. Inner Primer PCR Length: 2771 bp. Deletion Size: 1348 bp. Deletion left flank: AATCACTACCTTATGAAGGTCGAATGAGCA. Deletion right flank: AAATCAATTTCGAACTCAGTTTTCAAATTC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M01E11.6. Homozygous. Outer Left Sequence: CGTAACCAAATTCCGCTCAT. Outer Right Sequence: GTAATCCATTCGATTTGGCG. Inner Left Sequence: TGCCATTTTCGAATTCATCA. Inner Right Sequence: AGGGGCTGATTTCCTCATTT. Inner Primer PCR Length: 2341 bp. Deletion Size: 1283 bp. Deletion left flank: ATAACGTTATTTTACATGAAATGTTAGAAT. Deletion right flank: AGTGAAATCAGCTTGCGATCCGCTCCTTCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F14F8.1, F14F8.8. Homozygous. Outer Left Sequence: TTTTCCCAACGTAGTGAGCC. Outer Right Sequence: GCCACAGGGTACGATAGCAT. Inner Left Sequence: AGGTTTTCAAAGTGCGTTCC. Inner Right Sequence: GCACAAAATCTCCCCCACTA. Inner Primer PCR Length: 2153 bp. Deletion Size: 1443 bp. Deletion left flank: AAAAAATTCTTAAAGATTCTGGAAGTTTTC. Deletion right flank: TATCCGGGCCGGCATCTATCTGCTTAATTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C29E4.4. Homozygous lethal deletion chromosome balanced by bli-4-, let-?- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1954 homozygotes (probable early larval arrest). Homozygous hT2[bli-4 let-? qIs48] normally inviable; occasional recombinants are seen (Bli, bright GFP). Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGGCTTCCAATTTGACATCG. External right primer: CCACTCGACTTCCACCTTGT. Internal left primer: CATTCATCTTTCGCTGGGTT. Internal right primer: GTCTGCTGGCTTTCCAAGAG. Internal WT amplicon: 3083 bp. Deletion size: 1597 bp. Deletion left flank: ATACCCGGCACTGGTGAAAGAGGCCTTTCT. Deletion right flank: ATGGCAGAGTCGGAAGAGGAATTAAAGGCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F47B7.5. Superficially wild type. External left primer: TCCGGAGCCATTGTAATCTC. External right primer: TTCAGGCATGCAAGTTATGC. Internal left primer: ATCAAACCGAAATGGGACAG. Internal right primer: CGAAGATGACACGATGGATG. Internal WT amplicon: 2546 bp. Deletion size: 1375 bp. Deletion left flank: AGCCTGACACCACGTATGTAGTTGGAATAA. Deletion right flank: TTGCGAGTGTTGTCATTATCGTTATCTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F41D9.5. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1953 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. External left primer: CCTCGTAAGGGTAATTGGCA. External right primer: TCCAAGAAGGAGTGGTCCAG. Internal left primer: TTCATCAACAGCAGTTTGGC. Internal right primer: CAACGTGCATATCCCAACAG. Internal WT amplicon: 3086 bp. Deletion size: 2464 bp. Deletion left flank: GTTTCTGACATGACCTCTTCAGAATTTTCA. Deletion right flank: GAGGAAATCTGTTGATTAAATAATGAGTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F37A4.8. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1951 homozygotes (sterile adult). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCTGCTCGATCACGTCAAAC. External right primer: AGAAATCCGGCAAGCATCTA. Internal left primer: TACAGCTTGCCGGAAAAATC. Internal right primer: TAAACGCCCGAGGTAATTTG. Internal WT amplicon: 2817 bp. Deletion size: 1866 bp. Deletion left flank: TTTCTGGGCTTCCGACATACGACCTTGTTG. Deletion right flank: GCGGCGTCGGACGATTCCGGTTCATCGTCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C26H9A.1. Viable, fertile, slow-growing, sometimes sterile. External left primer: CAACGCCTACAGTGCTCAAA. External right primer: TGAGCAGCATCACCAAACAT. Internal left primer: TGACGACGGTTTCCACAATA. Internal right primer: TCTCCAAAATGCCTACCTGG. Internal WT amplicon: 2817 bp. Deletion size: 1749 bp. Deletion left flank: ATTTGAAAACTTTTCTGAAAGTCTCACAAT. Deletion right flank: GTATTTCAAAGTATTGTTGATTCATATGGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T21C12.2. Superficially wild type. External left primer: TTGTGGCTGTGCACATTTTT. External right primer: AACATCCCCGTAGCCATTCT. Internal left primer: CGGCAATTTGTCAAAAATCA. Internal right primer: AAAACAGGAAACCGTTGTGG. Internal WT amplicon: 2256 bp. Deletion size: 1363 bp. Deletion left flank: TAATTCAGAACTCGGAAATCACCTTGTTCA. Deletion right flank: GCCCGTGGCTGTGAATTCCTTTCCATTCCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807