More Fields
Strain Species Genotype
CB7448 C. elegans bus-5(e3133) X. Show Description
Slightly skiddy, bleach-sensitive, drug-sensitive, Bus (M. nematophilum resistant), Bah (Yersinia biofilm resistant), Leucobacter Verde1 hypersensitive. CRISPR/Cas9-induced deletion. Reference: O'Rourke et al (in preparation).
CF2310 C. elegans kri-1(ok1251) I; glp-1(e2141) III; muEx353. Show Description
muEx353 [kri-1(cDNA, a-isoform)::GFP + odr-1p::RFP]. Pick RFP+ to maintain. Temperature sensitive. Sterile at 25C; maintain at 15-20C. Reference: Berman JR and Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.
COP1626 C. elegans ins-34(knu572) IV. Show Description
F52B11.6. Superficially wild-type. knu572 is an F125L point mutation mimicking human mutation F119L in patients with PMM2 deficiency disease. Strain is sensitive to bortezomib (proteasome blocker) and displays larval arrest in liquid culture. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
COP1863 C. elegans goa-1(knu751) I. Show Description
Hyperactive, protruding vulva. knu751 is an A221D point mutation associated with GNAO1-associated epileptic encephalopathy. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
COP1918 C. elegans rskn-1(knu796) I. Show Description
Superficially wild-type. knu796 is a K216E point mutation mimicking a patient allele associated with Coffin-Lowry syndrome. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
COP2004 C. elegans agl-1(knu860) II. Show Description
Superficially wild-type. knu860 is a W1044X point mutation associated with Cori Disease. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
COP2008 C. elegans agl-1(knu864) II. Show Description
Superficially wild-type. knu864 is a S1444R point mutation associated with Cori Disease. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
COP2012 C. elegans agl-1(knu867) II. Show Description
Superficially wild-type. knu867 is a 6955 bp deletion in agl-1. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.services/. For more information, please contact ethan@perlara.com
COP2014 C. elegans sul-1(knu869) X. Show Description
knu869 is a 4077 bp deletion in sul-1. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.services/. For more information, please contact ethan@perlara.com
COP677 C. elegans ncr-1(knu4) X. Show Description
Cholesterol-sensitive. Smaller broods and sizes upon serial cholesterol deprivation. This strain may not be distributed to commercial or for-profit entities. Please contact ethan@perlara.com for more information.
CX5757 C. elegans kyIs140 I; nsy-4(ky616) IV. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. 2-AWC OFF.
DC19 C. elegans bus-5(br19) X. Show Description
Severe missense mutation. Bus (resistant to M. nematophilum), Bah (resistant to Yersinia biofilm formation), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1, drug and bleach sensitive. Slightly skiddy movement. Useful for drug screening. Reference: Xiong H, et al. Sci Rep. 2017 Aug 29;7(1):9839.
DM8005 C. elegans raIs5. Show Description
raIs5 [myo-3p::GFP::myo-3 + rol-6(su1006)]. Rollers. raIs5 produces a fully functional GFP-tagged myo-3 protein that localizes to myofilaments in muscle cells. Derived by integrating stEx30 in DM5133. Reference: Meissner B, et al. PLoS Genet. 2009 Jun;5(6):e1000537.
DWF1105 Acrobeloides sp. Show Description
Isolated in Arizona desert. Identification by E. Mae Noffsinger.
DWF1106 Acrobeloides sp. Show Description
Isolated in Arizona desert. Identification by E. Mae Noffsinger as Acrobeloides obliquus.
DWF1107 Acrobeloides butschlii Show Description
Original sample from peach orchard at Lodi CA. Original culture sent to DWF from B. Jaffee. Identification by E. Mae Noffsinger.
DWF1110 Acrobeloides ellesmerensis Show Description
Mentioned in Soil Biol. Biochem 25(9): 1141-1151, 1993. Sent to DWF from E.M. Noffsinger. Isolated in CA.
DWF1604 Operculrhabditis sp. Show Description
Originally from UCR collection. Identification by E. Mae Noffsinger.
EG9876 C. elegans unc-119(ox819 oxTi1126) III. Show Description
oxTi1126 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Knock-in into previously modified unc-119(ox819) endogenous locus. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. The Cas9 transgene was optimized for germline expression by including 4 large PATC-rich introns from smu-2. Lower activity than other Cas9 strains, but useful because Cas9, Cre, and unc-119 are in a single unit. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9881 C. elegans unc-119(ox819) F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Integrated Cas9 transgene linked to unc-119(ox819). Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9882 C. elegans F53A2.9(oxTi1127) III. Show Description
oxTi1127 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272] III. Inserted into F53A2.9. High Cas9 activity. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9887 C. elegans W01A8.6(oxTi1128) I; unc-119(ox819) III. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EG9888 C. elegans W01A8.6(oxTi1128) I. Show Description
oxTi1128 [mex-5p::Cas9(+smu-2 introns)::tbb-2 3'UTR + hsp-16.41p::Cre::tbb-2 3'UTR + myo-2p::2xNLS::cyOFP::let-858 3'UTR + lox2272]) I. Outcrossed to remove unc-119 mutation. Superficially wild-type. Cas9 insertion marked with myo-2p::cyOFP (cyan-excitable Orange Fluorescent Protein), a long-Stokes-shift fluorescent protein that is spectrally separable from common green and red fluorophores. Inserted into W01A8.6. Reference: Schwartz ML, et al. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. bioRxiv 2021.08.03.454883; doi: https://doi.org/10.1101/2021.08.03.454883
EM464 C. remanei ssp. vulgaris Show Description
Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Previously called C. vulgaris BK and C. vulgariensis BK. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633 and WBPaper00003993.
EU1065 C. elegans unc-119(ed3) III; orIs1. Show Description
Appears WT. orIs1 [pie-1p::GFP::mei-1 + unc-119(+)]. Maintain at 20C or above. Below 20C the GFP signal turns off.
EU1446 C. elegans unc-119(ed3) III; orIs14. Show Description
orIs14 [pie-1p::GFP::efa-6c::pie-1 3'UTR + unc-119(+)]. pie-1 promoter-driven N-terminal GFP fusion to EFA-6 isoform C. Reference: O'Rourke SM, et al. Nat Cell Biol. 2010 Dec;12(12):1235-41.
GE42 C. elegans vab-7(e1562) pha-1(e2123) III. Show Description
Temperature sensitive. Maintain at 15C. pha-1(e2123) is embryonic lethal at 25C. Hermaphrodites have an abnormal tail: sometimes twisted, tail whip never formed, often bobbed; sometimes uncoordinated with bent tail. Adult male tail deformed also.
GG31 C. elegans emb-21(g31) II. Show Description
Temperature sensitive. Maintain at 15C. Will grow at 20C, but not at 25C. [11/93: Not behaving as described. Very sick at 25C, but giving some live offspring which in turn give a few more live offspring.]
GG39 C. elegans emb-23(g39) II. Show Description
Temperature sensitive. Maintain at 15C. Embryonic lethal.(Some growth at 20C.) [11/93: Not behaving as described. Very sick at 25C, but giving some live offspring which in turn give a few more live offspring.]
GR2118 C. elegans daf-9(e1406) dpy-7(sc27) X; mgEx663. Show Description
mgEx663 [dpy-7p::daf-9B(cDNA)::GFP + mec-7::GFP]. Pick GFP+ to maintain. GFP fusion containing 0.4 kb dpy-7 promoter and daf-9 isoform B cDNA. Reference: Mak HY, Ruvkun G. Development. 2004 Apr;131(8):1777-86.
GR2255 C. elegans moc-2(mg595) V. Show Description
Can be maintained on OP50. Requires dietary Moco for viability. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR2256 C. elegans F49E2.1(mg589) X. Show Description
F49E2.1. Can be maintained on OP50. Requires dietary Moco for viability. Reference: (F49E2.1 referred to as moc-5) Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR2257 C. elegans cth-2(mg599) II. Show Description
Can be maintained on OP50. Suppresses Moco-deficient larval lethality. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR2260 C. elegans cdo-1(mg622) X. Show Description
Can be maintained on OP50. Suppresses Moco-deficient larval lethality. Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR3055 C. elegans suox-1(mg663)/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X Show Description
Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
HR505 C. elegans unc-59(e261) tba-2(sb51)/hIn1 [unc-54(h1040)] I. Show Description
Dominant temperature sensitive maternal-effect embryonic lethal. Maintain at 15C. Heterozygotes are WT. hIn1 homozygotes are Unc. Early cleavage spindles small and misoriented, cytokinesis often incomplete. Recessive non-temperature sensitive maternal-effect embryonic lethal (but sterile in conjuction with unc-59).
HR592 C. elegans memi-1(sb41) dpy-20(e1282)/nT1 [unc-?(n754) let-?] IV; +/nT1 V. Show Description
Dominant ts maternal-effect embryonic lethal. Embryos show extensive cytoplasmic blebbing, often accompanied by small spindles and incomplete cytokinesis. Two cell embryos divide synchronously. Embryos arrest with eight to several hundred cells. Recessive non-ts maternal-effect embryonic lethal. Null may be WT. Maintain at 15C.
HR83 C. elegans mel-24(ct59) dpy-20(e1282)/unc-24(e138) daf-15(m81) IV. Show Description
Heterozygotes are WT and segregate WT, Unc Dauers, and Dpys which throw dead eggs. Maintain by picking WT. ct59 animals are viable and fertile at 15C. ct59 is a temperature sensitive dominant maternal effect lethal. ct59 hets give more viable offspring at 15C than 25C.
IC765 C. elegans npr-9(tm1652) X; quEx182. Show Description
quEx182 [npr-9(+) + sur-5::GFP + odr-1::RFP]. Maintain by picking GFP+. Rescuing npr genomic fragment co-injected with sur-5::GFP and odr-1::RFP]. transgenic (GFP+) animals tend to wander off the food.
IK721 C. elegans njIs9 IV. Show Description
njIs9 [glr-3p::snb-1::venus + ofm-1::GFP] IV.
IX3447 C. elegans kyIs140 I; vyEx1462. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. vyEx1462 (die-1(fosmid)::Venus + odr-1::DsRed + ofm-1::DsRed). Pick animals with DsRed+ coelomocytes to maintain. Animals with vyEx1462 show 2AWC(OFF) phenotype. Extrachromosomal array rescues die-1(w34).
IX3597 C. elegans kyIs140 I; vyEx1510. Show Description
kyIs140 [str-2::GFP + lin-15(+)] I. vyEx1510 (ceh-36p::die-1(cDNA) + odr-1::DsRed + ofm-1::DsRed). Pick animals with DsRed+ coelomocytes to maintain. Animals with vyEx1510 show 2AWC(OFF) phenotype.
JJ1271 C. elegans glo-1(zu391) X. Show Description
Lacks autofluorescent and birefringent gut granules.
JK1573 C. elegans ces-1(n703) qDf6/dpy-14(e188) unc-13(e51) I. Show Description
Heterozygotes are Ces and grow very slowly and are often sterile. They segregate very early larval lethals, sickly DpyUncs and more hets. ces-1(n703) is dominant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK2751 C. elegans sys-1(q544) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT. q544 is homozygous embryonic lethal. hT2[qIs48] homozygotes are inviable. PIck GFP+ wild-type to maintain. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3447 C. elegans fog-1(q250)/sep-1(e2406) I; fbf-1(ok91) fbf-2(q704)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
To maintain, check individual fertile worms for both Sep and Fog offspring. sep-1 homozygotes are sterile at 20C and 25C (Sterile and Unc at 25C), and mostly normal at 15C. fog-1; fbf-1 fbf-2 homozygotes have small germ lines and are often Muv. Best to maintain at 25C for scoring. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JK3965 C. elegans fbf-1(ok91) fbf-2(q704)/mIn1 [mIs14 dpy-10(e128)] II; fem-3(e1996)/qIs24 IV. Show Description
qIs24 [lag-2p::GFP]. Maintain by picking individual animals with green DTCs and green pharynx and scoring offspring for Fems and Fbfs. fem-3 is not well balanced by qIs24. fbf-1 fbf-2 homozygotes are germline proliferation defective and make only sperm. fem-3 homozygotes make only oocytes. fbf-1 fbf-3; fem-3 proliferates more than fbf-1 fbf-2 and makes only oocytes; also Muv. qIs24 contains lag-2::GFP; Distal Tip Cells are green; homozygotes are Rollers and heterozygotes Roll weakly. mIn1 is Dpy and GFP+ in the pharynx. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JN2722 C. elegans daf-2(pe2722) III. Show Description
daf-2(pe2722) is a daf-2c-isoform specific mutation. pe2722 is a CRISPR/Cas9-engineered 41 bp deletion (ggttgatgacgatgatgagcccggcggcaggaggcagtgagcaaca) in daf-2 exon 11.5. Guide RNA sequence: gacgatgaagagcccggcgg. Reference: Nagashima T, et al. PLoS Genet. 2019 Jul 19;15(7):e1008297. PMID: 31323047
JU1084 C. remanei Show Description
Male-female strain. Isolated by Marie-Anne Felix from decomposing fruit and vegetables sampled on March 14, 2007, in small vegetable gardens next to the Kacho-en aviary (ca. 100 m) in Kakegawa, Shizuoka prefecture, Japan. Isofemale line. Maintain by mating.
JZ500 C. elegans pyIs500. Show Description
pyIs500 [ofm-1p::GFP + odr-1p::DsRed + odr-3p::GFP::egl-4]. Reference: O'Halloran DM, et al. PLoS Genet. 2009 Dec;5(12):e1000761. Lee JL et al. Proc Natl Acad Sci USA. 2010 Mar 30;107(13):6016-21.