More Fields
Strain Species Genotype
PS8303 C. elegans oac-59(sy1260) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-59; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCACCGTCTTCAAAACGGCTGGACCTTCAAGGCAT. Right flanking sequence: TAGAGGGTTGGCAATTCTATCAGTTCTGGGATTTC inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGACCTTCAAGGCATTAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616