More Fields
Strain Species Genotype
CB4000 C. elegans sma-1(e30) V. (high Tc1 copy number) Show Description
High Tc1 copy number, arose spontaneously in CB30. Him. Small, roundheaded.
CB4852 C. elegans Show Description
Wild type. Low Tc1 copy number; pattern X. [Obtained from Rothamsted by S. Brenner as 'Panagrellus redivivus'. Cross fertile with C. elegans N2.] Caenorhabditis elegans wild isolate. CB subclone of N3 (Tc1 pattern X).
CER178 C. elegans nfki-1(cer1) X. Show Description
cer1 is a CRISPR-generated 368 bp deletion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
CER187 C. elegans nfki-1(cer2) X. Show Description
cer2 is a CRISPR-generated 438 bp deletion + 50 bp insertion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
CER244 C. elegans ikb-1(cer9) I. Show Description
cer9 is a CRISPR-generated 462 bp deletion at the beginning of the ikb-1 coding sequence, including the start codon (no transcript should be synthesized). Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
DCL569 C. elegans mkcSi13 II; rde-1(mkc36) V. Show Description
mkcSi13 [sun-1p::rde-1::sun-1 3'UTR + unc-119(+)] II. Germline rescue of the rde-1(mkc36) indel mutation, allowing germline-specific RNAi. Reference: Zou L, et al. Scientific Reports Volume 9, Article number: 2354 (2019) "Construction of a germline-specific RNAi tool in C. elegans."
DH1300 C. briggsae Show Description
DH subclone of C. briggsae Zuckerman. This stock was maintained in liquid culture for some number of years, and has acquired mutations that have not been named or mapped. It is Unc, dauer-defective and ts lethal. Previously called C. briggsae BO.
DR1690 C. briggsae C. briggsae. Show Description
Previously called C. briggsae Zuckerman. This stock was maintained in liquid culture for some number of years and carrues a 33-kilobase deletion that disrupts one of the srg paralogs, CBG24690, and six other genes. It is Unc, dauer-defective and ts lethal. Reference: McGrath PT, et al. Nature. 2011 Aug 17;477(7364):321-5.
EC106 C. elegans eeEx106. Show Description
eeEx106 [hil-1::GFP + rol-6(su1006)]. GFP expression in body wall muscles, in the vulva sex muscles, in the marginal cells of the pharynx, in a limited number of head neurons, in the cytoplasm of excretory cells. The expression starts in the about 100-cell embryo in a few cells in the periphery in the nucleoplasm and in the nucleoli. Complex extrachromosomal arrary....pick Rollers. About 20% Rollers.
EG4322 C. elegans ttTi5605 II; unc-119(ed9) III. Show Description
Unc. Not caused by ttTi5605. Mos1 allele generated by NemaGENETAG consortium (Laurent Segalat). [NOTE: 11/15/11 - This strain contains unc-119(ed9), not unc-119(ed3) as previously reported. (C. Frokjaer-Jensen)] [NOTE: The Dernburg lab has noticed an increased number of rad-51 foci in EG4322 compared to N2. Please use the outcrossed version of this strain (EG6699) instead, which does not have this problem. (C. Frokjaer-Jensen)]
EG4788 C. portoensis Show Description
Male-female strain. Maintain by mating. Caenorhabditis sp. 6 wild isolate. Isolated by Michael Ailion and Ana-Joao Rodrigues from a rotting apple collected from the home of Anabela Fernandes in Amares, Portugal (address: Dr. Adolofo Vilela, no. 29, 4720-019 Amares, Portugal). Coordinates: 41 degrees, 37', 43.577 " N; 8 degrees, 20', 51.421 " W. Apple collected March 28, 2007. The apple produced a number of growing animals in different stages, including adults of both sexes. Male/Female Caenorhabditis species. 18S RNA sequence places it closest to PS1010 C. sp. 3.
EG4887 C. elegans oxIs322 II; unc-119(ed3) III. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. Wild type worms with mCherry fluorescence in pharyngeal and body wall muscle. Visible on dissection microscope at high magnification. Complex transgene insertion in place of Mos1 allele ttTi5605. Useful for following "invisible" insertions at ttTi5605 site by Mos1 Single Copy gene Insertion (MosSCI). Please note: The insertion was a complex event pulling in more than one transgene and parts of the array. Therefore, the exact molecular structure of the insert is not known. Therefore the strain should NOT be used as a control for insert copy number or other detailed molecular controls of MosSCI insertions. Succesfully used as a balancer for the ttTi5605 locus.
GH378 C. elegans pgp-2(kx48) I. Show Description
Reduced number of birefringent gut granules in embyros and a mislocalization of birefringence to the lumen. Faint autofluorescent gut granules in adults.
HBR1261 C. elegans goeIs288. Show Description
goeIs288 [flp-11p::mKate2::unc-54 3'UTR + unc-119(+)]. Low copy number insertion. Integration site unknown, but likely not in LG II. Reference: Turek et al. eLife 2016;5:e12499.
HZ1569 C. elegans bpIs239. Show Description
bpIs239 [W07G4.5p::W07G4.5::GFP + unc-76(+)]. W07G4.5::GFP is expressed in the intestine. A few GFP aggregates are formed in wild-type embryos at the four-fold stage; the number of aggregates is dramatically increased in epg-7 and atg-3 mutants. Reference: Lin L, et al. J Cell Biol. 2013 Apr 1;201(1):113-29.
HZ620 C. elegans ceh-16(bp323) III; wIs51 V. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Temperature-sensitive: maintain at 20C or lower. bp323 mutants show reduced number of seam cells when raised at restrictive temperature (25C). Reference: Huang XX, et al. Dev Biol. 2009 Sep 15;333(2):337-47.
HZ946 C. elegans rpl-43(bp399) II; bpIs151. Show Description
bpIs151 [sqst-1p::sqst-1::GFP + unc-76(+)]. bp399 mutants accumulate SQST-1 aggregates strictly in the intestine in a distinct temporal pattern. SQST-1::GFP aggregates are absent in bp399 embryos, but start to form in L1 larvae and increase in number and size throughout larval development. Reference: Guo B, et al. EMBO Rep. 2014 Jun;15(6):705-13.
JJ1238 C. elegans unc-30(e191) mex-5(zu199) IV/nT1 (IV;V). Show Description
Heterozygotes are WT. Embryos from unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching.
JJ1244 C. elegans mex-6(pk440) II; unc-30(e191) mex-5(zu199) IV/nT1 (IV;V). Show Description
Heterozygotes are WT. Embryos from mex-6; unc-30 mex-5 homozygotes produce approximately the WT number of cells but do not undergo body morphogenesis and die without hatching.
KR1588 C. elegans dpy-5(e61) let-539(h938) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. Show Description
Heterozygotes are WT and segregate WT, arrested DpyUncs, Lon males and large number of aneuploid progeny (arrested embyros or larvae). Note that unc-29 is outside the recombination-suppressed region of szT1 and may cross off resulting in Unc-29 progeny. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR1594 C. elegans dpy-5(e61) let-542(h986) unc-13(e450)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. Show Description
Heterozygotes are WT and segregate WT, arrested DpyUncs, Lon males and large number of aneuploid progeny (arrested embyros or larvae). Note that unc-29 is outside the recombination-suppressed region of szT1 and may cross off resulting in Unc-29 progeny. Pick WT and check for correct segregation of progeny to maintain. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Ann Rose.
KR1598 C. elegans dpy-5(e61) unc-13(e450) let-538(h990)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. Show Description
Wild-type phenotype. Segregates WT, sterile adult DpyUncs, Lon-2 males (szT1 hemizygotes) and a large number of arrested aneuploid progeny (mostly dead eggs). Pick WT and check for correct segregation of progeny to maintain. Note that unc-29 on szT1(I) lies in the non-balanced region and may recombine onto the normal LG I.
KR1692 C. elegans dpy-5(e61) unc-13(e450) let-535(h993)/szT1 [lon-2(e678) unc-29(e403)] I; +/szT1 X. Show Description
Wild-type phenotype. Segregates WT, mid-larval arrested DpyUncs, Lon-2 males (szT1 hemizygotes) and a large number of arrested aneuploid progeny (mostly dead eggs). Pick WT and check for correct segregation of progeny to maintain. Note that unc-29 on szT1(I) lies in the non-balanced region and may recombine onto the normal LG I.
KR1787 C. elegans unc-13(e51) I. Show Description
The origin of this strain is KR1082 via CB51. KR1082 was maintained on plates for a period of approximately two years. After this time, DNA was made and the Tc1 pattern examined. The number of Tc1s found in KR1787 was greater than that found in KR1082. Perhaps as many as 30 additional Tc1s were visible in excess of those normally seen in N2 strains.
KX110 C. elegans ced-9(n1653) mab-5(mu14) III; bcIs39 V. Show Description
bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V.  Temperature sensitive induction of germ cell apoptosis at 25 C. Large number of germ cells are decorated by CED-1::GFP within 48 h. Activates CED-3-mediated cleavage of IFG-1, visualized by western blot (Contreras, V., et al, 2011).
MJ563 C. elegans tpa-1(k530) IV. Show Description
Animals grow to be adults with smaller than normal body size and produce a reduced number of progeny on TPA-containing medium. No other apparent phenotypes were so far observed on NGM. Tc1 was originally inserted into a 2.4 kb HindIII genomic fragment. The 1.8 kb portion adjacent to the 3' end of the inserted Tc1 was replaced by an unidentified 1.0 kb fragment probably due to rearrangement during backcrossing.
ML514 C. elegans che-14(ok193) I. Show Description
Animals are dye-filling negative. A bit sick with about 30% dying during larval development and the others displaying a number of defects in organs/tissues containing hypodermal cells (hypodermis, rectum, vulva, excretory system).
NC1730 C. elegans unc-5(e152) IV; wdIs52. Show Description
wdIs52 [F49H12.4::GFP + unc-119(+)]. PVD defects in primary branch guidance, number of secondary branches, and tertiary branches are longer than wild-type.
NL4000 C. elegans sma-1(e30) V. NL subclone of CB4000. Show Description
NL subclone of CB4000. High Tc1 copy number strain. See WBG 14(4): 16-17.
QC128 C. elegans paqr-1(tm3262) IV. Show Description
Superficially wild-type. paqr-1(tm3262) have an increased number of small lipid droplets when combined with paqr-2(tm3410) in double mutants. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
SS222 C. elegans mes-3(bn21) I. Show Description
Strict maternal effect sterile at 25C. TSP during embryogenesis. The progeny of homozygous mothers, raised at the restrictive temperature, are sterile. Sterile worms have dramatic reduction in number of germ cells (10-100 fold less than WT).
SS262 C. elegans mes-3(bn35) dpy-5(e61) I; sDp2 (I;f). Show Description
Animals with the Duplication have a WT phenotype. Animals which have lost the Duplication are Dpy and give sterile Dpy progeny. Strict maternal effect sterile. Sterile worms have a dramatic reduction in number of germs cells (10-100 fold less than WT). See also WBPaper00002343.
TJ356 C. elegans zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: johnsont@colorado.edu. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects.
TR388 C. elegans Show Description
Wild type. Low Tc1 copy number. Isolated in Madison, WI. Caenorhabditis elegans wild isolate (Tc1 pattern I?).
TR389 C. elegans Show Description
Wild type. Low copy Tc1 number. Isolated in Madison, WI. Caenorhabditis elegans wild isolate (Tc1 pattern I?).
TR403 C. elegans Show Description
A wild type C. elegans virtually indistinguishable from N2. Males mate with high efficiency, unlike Bergerac. High copy number of Tc1 elements. Active for Tc1 transposition and excision. Not temperature sensitive for growth (unlike Bergerac). See also WBPaper00001053 and WBG 10(2) 140-141 and 11(5) 60. Collected from soil in Madison, WI. Caenorhabditis elegans wild isolate (Tc1 pattern HCD).
TY1936 C. elegans dpy-30(y228) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and temperature sensitive Dpys. At 15C the y228 homozygotes (derived from heterozygous mothers) are WT and most of their progeny are inviable, dying as arrested embryos or as necrotic Uncoordinated and Constipated L1 larvae; a small number of animals survive and develop into Dpy, Egl adults with a protruding vulva. At 25C the y228 homozygotes (derived from a heterozygous mother) are Dpy and Egl and have a protruding vulva; progeny from these animals are inviable and die as embryos or L1 larvae. See also WBPaper00002302.
VC10116 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in M01D1.2 (gk1188), identified by CGH (Comparative Genome Hybridization). Minimum deletion size: 345 bp; maximum size 5952 bp. Left flanking probe: TGAAATCGGTGAGCTTTTGGTCTGGGTAAGCTCTCAGGAGGAGCCAGCCT. Right flanking probe: CTATTCAACCCCCATGCGTTGGATGAAGCCTTCCCAATGTCCAACCTTTA. Left deleted probe: AAGCCCTGCGATCACTGGTAAGCTCCTGATCACCCTATTACTTGCACAGT. Right deleted probe: AATCGCAGAGATTGTCAGCGACTTGAAGCTCGGCGGATTGGACAGGCCGT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10118 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10124 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in B0310.1 (gk1191), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: GAATCCGAGAAAAGCGTCTG. External right primer: GATCTTTTGGCCTTTTGCTG. Internal left primer: TCATCCACGTAGACTTGCCA. Internal right primer: TTGCAATCCTGAAGCAAATG. Internal WT amplicon: 2706 bp. Maximum deletion size: 1911 bp. Minimum deletion size: 881 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: CAAAACGCGTGTTAACCCTGTGCCATCTGTCTGATCCGACTCAGAAAACA. Left deleted CGH probe: TTTCTGAATACAAGAGAAGAGCATAATGGGCGCTGATCTTCCACCGAAAT. Right deleted CGH probe: AATACATTTAAGCTACACACCTACTTGCCTGCTCTCAGTGTGACCGAAAA. Right flanking CGH probe: AAGTTTATGGGCCTGAAACAATTGTATTTTCGTATCTTGACATTGATAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10126 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10127 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F19C6.1 (gk1192), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: CGAACTCGCCGTTCTACTTC. External right primer: GTTTTAGCGGCTTCAACTGC. Internal left primer: CGTCCCTTGATTGGTTCATT. Internal right primer: GATTCTCATTGGCAGACGGT. Internal WT amplicon: 3924 bp. Approximate deletion size: 2575 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking CGH probe: TTCGTTCAAGCTTAATGTTTCAGCATGCCTCTTCTTGACTCGCTTCTTTT. Left deleted CGH probe: TCCGGTACCAATTGTCGACTTGCTACCATTTTACGACCGCACAACTAAAA. Right deleted CGH probe: TAGTGAGGGAACTGTAGATAATTCTTCCACTTTTTGCTTTTTCCTTTCTT. Right flanking CGH probe: TACCGTATTGGCAACGATATTTTCAATCTCCATGGTCCTATCGTGGCTGA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10128 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10129 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10130 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10165 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries a homozygous deletion in F42A10.1 (gk1194), identified by CGH (Comparative Genome Hybridization), which can be detected by PCR with the following primers. External left primer: TGGCTTTGCAATCTGTTGAG. External right primer: ATGCTTGCTCGTTGTCTGTG. Internal left primer: ACTTGATTCTTGACGAGCCT. Internal right primer: CAACTGATAAGAGTGGTTCGCA. Internal WT amplicon: 906 bp. Maximum deletion size: 137 bp. Minimum deletion size: 101 bp. The deletion was confirmed by PCR, but was not sequenced. Left flanking probe: TTTTGTTTCGCATTCGGTTGTTTCCCATATTTCACCCAGTTTCCACGTTT. Left deleted probe: TATTAAATTGTTCACTTCAAAATTTAAGTATGAGTGAGAGCTCTAGCCTG. Right deleted probe: AAATAATGCAAAGGTCTTCCTTGCTCGGGTCATCATGAAGAAGATACTCG. Right flanking probe: GGGTCATCATGAAGAAGATACTCGAGTTGGTAAGGCTTATCGTTCTGAAA. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC10166 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after UV/TMP mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). It also carries homozygous deletions in C26C6.1 (gk1195) and F14D12.6 (gk1196), identified by CGH (Comparative Genome Hybridization), and confirmed by PCR but not sequenced. The deletions can be detected by the following primers. gk1195: External left primer: ACGGAAGTTCTCAAAGCGAA. External right primer: TCGTCTTCAGCAGTGAATGG. Internal left primer: GCAGGCTCTTCAATGTACGA. Internal right primer: TCTCGGAAAGGCGTAAGAAA. Internal WT amplicon: 506 bp. Approximate deletion size: 100 bp. gk1196: External left primer: CCGGGAAATCACAGCACTAT. External right primer: TACGAATGCAGCGACAGAAC. Internal left primer: AGGATTCACGACGAATGTCC. Internal right primer: CTTCTCGGTAACTTCGCCAC. Internal WT amplicon: 1785 bp. Approximate deletion size: 900 bp. gk1195 left flanking probe: GATGAGGAGGGAGGAAACAAACCGGCGATGGTGAAAAGACATGTAGGATA. gk1195 left deleted probe: TTTCTGCATGTTATTAATTAAATTCTTTTCAGGAAAGCGAAGTCGAAATG. gk1195 right deleted probe: ATATGTGGCACCATGTTACGCATACGTTTCCCGATCTGACGAGAAGAAAA. gk1195 right flanking probe: ACGCATACGTTTCCCGATCTGACGAGAAGAAAACTCCTCTTCACATTTTC. gk1196 left flanking probe: AGCAACCGACATCTGGACGACACGTCGCCGTAGCTCCTTTTGAGTGACGT. gk1196 left deleted probe: GCTCAAATTGCAAACTAGTTTTCATTTGTAGAACTCCATGAGTGGATGAA. gk1196 right deleted probe: TCTCTGTTTCCTTCAGTCGCTGCCTACTATGACGGATGGTTATACTGTAG. gk1196 right flanking probe: CTATGACGGATGGTTATACTGTAGATTTTGGCATAAACGATGATGAGAAT. Flanking sequences represent the nearest array oligo sequences present in the deletion chromsome on the basis of fluorescence ratio. These should not be considered hard breakpoints in the absence of actual sequence data. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20007 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20008 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537
VC20009 C. elegans Show Description
Million Mutation Project strain. This strain was isolated after EMS mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( http://genome.sfu.ca/mmp/). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00042537