More Fields
Strain Species Genotype
VC914 C. elegans hsp-90(ok1333) V/nT1 [qIs51] (IV;V). Show Description
C47E8.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1333 homozygotes (paralyzed Unc, mid- to late-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Previously known as daf-21. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC930 C. elegans uba-1(ok1374) IV/nT1 [qIs51] (IV;V). Show Description
C47E12.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1374 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC940 C. elegans let-99(ok1403) IV/nT1 [qIs51] (IV;V). Show Description
K08E7.3. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1403 homozygotes (Mel; adult lays eggs, some hatch into abnormal L1s that arrest). nT1[qIs51] homozygotes inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC947 C. elegans vps-36(gk427) V/nT1 [qIs51] (IV;V). Show Description
F17C11.8. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP gk427 homozygotes (slow-growing, often sterile, mildly Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC958 C. elegans tag-329(ok1458) V/nT1 [qIs51] (IV;V). Show Description
C50F4.3. Homozygous viable deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1458 homozygotes (slow-growing with small broods, some larval lethality). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC959 C. elegans folt-1(ok1460) V/nT1 [qIs51] (IV;V). Show Description
C06H2.4. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1460 homozygotes (large, healthy sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC960 C. elegans tag-335(ok1456) IV/nT1 [qIs51] (IV;V). Show Description
C42C1.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1456 homozygotes (probable embryonic arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC964 C. elegans tag-321&tag-322(ok1422) IV/nT1 [qIs51] (IV;V). Show Description
C33H5.10, C33H5.19. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1422 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VL739 C. elegans nhr-45(tm1307) X; wwIs23. Show Description
wwIs23 [nhr-178p::GFP + unc-119(+)]. Decreased GFP expression in the pharynx; no detectable expression in Int1 cells. Reference: Arda HE, et al. (2010) Mol Syst Biol 6:367.
WH108 C. elegans abc-1(oj2) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, dead eggs and abc-1 homozygotes. At 25C abc-1 homozygotes are sterile Unc animals. At 16C abc-1 homozygotes are fertile animals that produce all dead eggs.
WH556 C. elegans mrck-1(ok586) V/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok586 homozygotes (Lvl). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kumfer et al. (2010) Mol Bio Cell21(2):266-77.
WM182 C. elegans csr-1(tm892) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. csr-1(tm892) homozygotes are non-Unc and Sterile.
WM214 C. elegans avr-14(ad1302) I; csr-1(tm892)/nT1 [unc-?(n754) let-?] IV; avr-15(ad1051) glc-1(pk54))/nT1 V; axIs36 X. Show Description
axIs36 [pes-10::GFP]. Heterozygotes are Unc and sensitive to ivermectin. Segregates csr-1 homozygotes (sterile, non-Unc, resisitant to ivermectin), dead embryos, and Unc heterozygotes. Maintain by picking Uncs. Do not distribute this strain; other labs should request it directly from the CGC. Reference: Claycomb JM, et al. Cell. 2009 Oct 2;139(1):123-34.
WM43 C. elegans gex-3(zu196) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Zygotic phenotype: 100% of gex-3 homozygotes become Egl although they all make a normal looking L3/L4 vulva. Embryonic phenotype: complete loss of morphogenesis - hypodermal cells fail to intercalate or migrate. Received new stock from Erik Lundquist 11/2003.
WRM31 C elegans sprDf1 V/nT1 [qIs51] (IV,V). Show Description
Pick GFP+ to maintain. sprDf1 is a ~0.25 Mb microdeletion allele on the left arm of chromosome V that removes 32 adjacent protein-coding genes, including mex-5. Heterozygous animals (GFP+) are fertile, but sometimes die by bursting, will have polynucleated embryos, and form uterine tumors ~6 days after hatching. sprDf1 homozygotes (GFP-) have maternal effect lethality, are small, sterile, form large uterine tumors that consist of poly nucleated embryos, have squashed vulvas, are uncoordinated, and die by bursting within eight days of hatching. nT1 homozygotes are inviable (dead eggs). Reference: Antkowiak KR, et al. G3 (Bethesda). 2023 Nov 13:jkad258. doi: 10.1093/g3journal/jkad258. PMID: 37956108.
WS5235 C. elegans ccz-1(t2129) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ccz-1 homozygotes (produce only arrested embryos with spindle orientation defects, accumulate vesicles, and problems engulfing apoptotic corpses). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Nieto C, et al. J Cell Sci. 2010 Jun 15;123(Pt 12):2001-7.
WU1854 C. elegans pcn-1(am315[3xFLAG]) IV/nT1 [qIs51] (IV;V). Show Description
Homozygous maternal effect lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP am315 homozygotes (maternal effect lethal). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. 3xFLAG epitope allows antibody detection of full-length PCN-1. Reference: Kocsisova Z, et al. BMC Dev Biol. 2018 May 30;18(1):12.
XA6400 C. elegans hlh-17(ok487) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+ in the pharynx. ok487 homozygotes arrest as early larvae and are GFP-. qIs51 homozygotes are inviable.
XK194 C. elegans unc-46(e177) let-479(s1576) V/nT1 [qIs51] (IV;V). Show Description
YHS25 C. elegans cdc-25.2(ok597) V/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok597 homozygotes (Emo, Ste). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Kim J, Kawasaki I, Shim Y. (2010) J Cell Sci 123:993-1000.
ZT3 C. elegans csr-1(fj54) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA.
ZT46 C. elegans csr-1(fj67) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj67) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Intracellular localization of CSR-1 is abnormal in the csr-1(fj67) homozygotes. fj67 is a 60-bp in-frame deletion of the first lysine-rich region (KQKDNFILLDILLKQWAAKK) in CSR-1. The first lysine-rich region in the WT has a FokI site. The deletion can be checked by PCR with the following primers: CACCTGTGATTTTTCGGGGAAC and TGGATTCCTTTTGCTGCAACAG, followed by digestion with FokI. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT47 C. elegans csr-1(fj70) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj70) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj70 is a D769L mutation that renders CSR-1 (an Argonaute protein) catalytically defective and generates a new SphI site. The fj70 mutation can be checked by PCR with the following primers: TACACGTGGATGATGAGAAG and TCGTCCGAAACTTCCTCATC, followed by digestion with SphI. Homozygous nT1[qIs51] inviable. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT57 C. elegans csr-1(fj126) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP csr-1(fj126) homozygotes (sterile, but some animals lay a small number of dead eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. fj126 was generated by the insertion of a synthetic nuclear export signal (NES). Instead of six amino-acid residues (R8–I13) near the N-terminus of CSR-1b, an NES sequence (LNELALKLAGLDI) from the cAMP-dependent protein kinase inhibitor alpha in mammals was inserted into the endogenous csr-1 gene. The DNA sequence encoding the NES has a HindIII site. The fj126 mutation can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and CCGCTGAGGAACGAGATGG, followed by digestion with HindIII. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
AV311 C. elegans dpy-18(e364) unc-3(e151) meT7 (III;X;IV). Show Description
Dpy. Unc. meT7 is an end-to-end-to-end fusion of chromosomes III, X, and V. The right end of III is fused to the left end of X, and the right end of X is fused to the left end of IV. Constructed by crossing eT5 and mnT12. meT7 homozygotes produce 92% viable progeny. meT7 heterozygotes are Him and produce many dead eggs.
CB3740 C. elegans eDf24 I; eDp20 (I;II); mnT12 (IV;X). Show Description
Phenotypically WT. See also CGC 801. eDf24 = let(e2000).
SP400 C. elegans mnT11 (X;II)/+ II; dpy-3(e27) X; mnDp11 (II;X;f). (mnT11 + mnDp11 = mnT2) Show Description
Hets are WT and segregate WT, Dpy and males of both kinds.
SP486 C. elegans mnT10 (V;X). Show Description
WT phenotype. Dominant him.
SP580 C. elegans mnT13 (I;X). Show Description
Dominant Him.
SP646 C. elegans mnT12 (IV;X). Show Description
Homozygous WT.