Heterozygote are fertile and Unc. spe-39(eb9) homozygotes are self-sterile due to defects in spermatogenesis.

Heterozygotes are Unc and express myo-2::GFP in the pharynx. unc-42(e270) spe-42(eb5) homozygotes are Unc and non-GFP. Whle unc-42(e270) spe-42(eb5) self progeny have not been quantified, spe-42(eb5) alone produces 9 self progeny at 16C and <1 self progeny at 25C. The Spe defect can be rescued by WT sperm. Homozygous nT1[unc-?(n754) let-? qIs50] are embryonic lethal.

Heterozygotes are Unc (n754 is a dominant Unc and recessive lethal). Throws DpyUncs which give sterile progeny. The maternal effect sterility is 99% expressed, 100% strict, and is associated with 2% maternal effect embryonic lethality.

Heterozygotes are Unc (n754 is dominant Unc and recessive lethal). Hets throw Dpys which give only sterile progeny. The maternal effect sterility is 99% expressed, 100% strict, and is associated with 1% maternal effect embryonic lethality.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP iow1 homozygotes (viable; see note below). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. iow1 is a separation-of-function allele of mre-11. Homozygotes develop into adults wild-type in appearance, but laying dead eggs due to defects in meiotic DSB repair: mre-11(iow1) worms form meiotic DSBs but are impaired in their resection. Pick GFP+ to maintain (mre-11(iow1)/nT1[qIs51]) and GFP- to obtain homozygous mre-11(iow1) worms for analysis. Reference: Yin Y & Smolikove S. Mol Cell Biol. 2013 Jul;33(14):2732-47. doi: 10.1128/MCB.00055-13. Epub 2013 May 13. Erratum in: Mol Cell Biol. 2015 Jul;35(14):2568. PubMed PMID: 23671188; PubMed Central PMCID: PMC3700128.

Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes. Balancer is prone to breaking down. If a population contains a mix of bright and dim GFP animals, pick dim GFP and check for correct segregation of progeny to maintain. iow53 inserted a GFP tag at the N-terminus of the endogenous rad-51 locus, but the tagged protein is not fully functional. non-GFP(pharynx) rad-51(iow53[GFP::rad-51]) homozygotes form GFP foci in the germline that are mostly spo-11 dependent, and GFP::rad-51 homozygotes have defects in unloading RAD-51. Created by CRISPR using pDD282, therefore may also contain 3XFLAG. Reference: Koury E, et al. Nucleic Acids Res. 2018 Jan 25;46(2):748-764.

Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk526 homozygotes (variable arrest, early larval). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.

Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) ubc-9(iow97[3xFLAG::ubc-9]) homozygotes. Maintain the strain by picking wild-type GFP+ worms and checking for correct segregation of progeny. iow97 was created by CRISPR/Cas9 insertion of a 3xflag tag at the N-terminus of the endogenous ubc-9 locus; however, the tagged protein is not fully functional. SSM491 is a replacement for SSM291: analysis shows that in all parameters tested, SSM491 is identical to SSM291, which was genetically unstable and prone to breaking down. Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.

Him. Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT. Reference: Agostinho A, et al. PLos Genetics 2013.

Heterozygotes are WT and segregate WT and dead eggs. 1/3 of the WT are rad-51(lg8701) homozygotes and will give only dead eggs.

Heterozygotes are WT and segregate WT, Dpys which give only dead eggs, and dead eggs.

let-99(dd17) contains a 647bp deletion with the flanking sequences aatttttaggaagtttccagaaatttttcc / CAAGGCTCCCACGAAGATTATCGCGATCTA. The deletion removes the N terminus of the open reading frame including the start codon and the DEP domain. Heterozygotes are GFP+ in the pharynx. dd17 is a maternal effect lethal mutation.

let-99(dd18) contains a 1039bp deletion with the flanking sequences TTTGGATGAGTTGAAGCATCCCAAGCCCCG / ATGAATGCTCTCTTATTGTTAATCTCCTCT. The deletion starts behind the DEP domain. Heterozygotes are GFP+ in the pharynx. dd18 is a maternal effect lethal mutation.

Dominant mutant phenotypes: Unc, Mec, Tab, Deg (late embryogenesis to L4). u662 was derived from DnT1 by recombination between the dominant Unc mutation and the recessive Lethal mutation. The dominant Unc mutation is what has been retained in this strain. This Unc mutation has been called unc-?(n754) in DnT1 strains. It is likely that unc-?(n754) and deg-3(u662) are the same mutation.

Heterozygotes are Unc and segregate Unc and non-Unc steriles (oma-1; oma-2 homozygotes). The Oma animal has an empty uterus and lots of oocytes in the gonad arms. Maintain by picking Uncs. zu405 is a gain-of-function mutation which results in temperature sensitive, embryonic lethality. Loss-of-function mutation in either oma-1 or oma-2 alone does not have a detectable phenotype. te33 is a dominant suppressor of the zu405 embryonic lethality. te51 is a mutation that, in the oma-1(zu405te33) background, gives an Oma (Ooctye Maturation defective) phenotype. [NOTE (09/2016; D. Greenstein, unpublished results): The two molecular changes in te33 are different than reported by Detwiler et al. (2001), but nonetheless result in a strong loss of oma-1 function. Sequencing of the original isolate of te33 gave the same result (S. Robertson and R. Lin, unpublished results).] This strain carrying oma-1(zu405te33) contains the following mutations: zu405 [C8889984T; P240L] and te33 [C8889978A, S238stop & C8889863T, H200Y].

Heterozygotes are WT and throw WT and dead eggs. yDf9 homozygotes arrest as dead eggs.

Heterozygotes are WT and segregate WT and dead eggs. yDf11 homozygotes arrest as dead eggs.

Unc strain which segregates Uncs and dead eggs.

Heterozygotes are DpyUnc and segregate DpyUnc and dead eggs.

Heterozygotes are Unc and segregate Unc, dead eggs and temperature sensitive Dpys. At 15C the y228 homozygotes (derived from heterozygous mothers) are WT and most of their progeny are inviable, dying as arrested embryos or as necrotic Uncoordinated and Constipated L1 larvae; a small number of animals survive and develop into Dpy, Egl adults with a protruding vulva. At 25C the y228 homozygotes (derived from a heterozygous mother) are Dpy and Egl and have a protruding vulva; progeny from these animals are inviable and die as embryos or L1 larvae. See also WBPaper00002302.

Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF, et al. Genes Dev. 2009 Aug 1;23(15):1763-78.

Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.

Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile rec-8(ok978); coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.

Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.

Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.

lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3S (short) splice isoform, expressed under control of the lin-3 promoter. The transgene rescues lethal and Vulvaless phenotypes (but not sterility) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.

lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3L (long) splice isoform, expressed under control of the lin-3 promoter. The transgene partially rescues lethal and Vulvaless phenotypes (but not sterility) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.

lin-3(-) heterozygous balanced strain containing single copy MOS-mediated insertion of csSi1 transgene encoding lin-3XL (extra long) splice isoform, expressed under control of the lin-3 promoter. The transgene partially rescues lethality (but not Vulvaless or sterile phenotypes) of lin-3 mutants, which can be recognized by absence of myo-2::GFP from the nT1 balancer. Pick GFP+ to maintain.

Heterozygotes are GFP+, and segregate non-GFP hermaphrodites which give only dead eggs. sun-1 is also called mtf-1.

C08F8.1. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP gk526 homozygotes (variable arrest, late larva to sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C42C1.5. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1455 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C10C5.6a. Homozygous lethal deletion chromosome balanced by translocation. Heterozygotes are WT and segregate WT, arrested nT1 aneuploids, vulvaless nT1 homozygotes, and ok1412 homozygotes (arrested incomplete dauers). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C48G7.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1511 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T10H9.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1546 homozygotes (arrest stage/phenotype undetermined). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C15H11.7, C15H11.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1531 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y49A3A.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1547 homozygotes (early larval arrest). Lethal phenotype is suspicious, as deletion appears to affect only intron sequence. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y73B6BL.6. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1582 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK863.7. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1549 homozygotes (sterile Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C53A5.3. Apparent homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1595 homozygotes (mid-larval arrest). Occasional non-GFP segregants grow up and reproduce, but it has not been determined whether these are true homozygotes or a rare recombinant class. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T14G10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1625 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: ATTCTCAGAAACCCACGCAT. External right primer: TCTCCACGAGGTTTACCACC. Internal left primer: ACGGGATGAAAACAACGAAG. Internal right primer: AAACGCGTGTCAATATGGGT. Internal WT amplicon: 2542 bp. Deletion size: 1092 bp. Deletion left flank: TGAACGTGTATGTCGTCAATTTGGAACAAA. Deletion right flank: AGAATAAGGAAAATATCAAGAAAATATGGC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y67H2A.6. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1604 homozygotes (sterile adult). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F15B9.1, F15B9.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok313 homozygotes (mid- to late larval arrest, may develop to adulthood and lay eggs). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F35H10.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1588 homozygotes (arrest stage/phenotype undetermined). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C42C1.11, C42C1.12. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok348 homozygotes (early to mid-larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y62E10A.8. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1592 homozygotes (thin twitcher, late larval or sterile adult arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TTTTTCCGGGTTTTACTGGA. External right primer: AGGAGAATGGGAGGCTCTTC. Internal left primer: GCGGGTTACTGTAGCAGCTC. Internal right primer: TCACTTGCATATCCACCAGC. Internal WT amplicon: 2234 bp. Deletion size: 593 bp. Deletion left flank: CCTTTTTTGATTTTTTAGAAAAAAACTTTT. Deletion right flank: TGTGAATATTTGACACGAATCGTTAAGATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F46F3.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1655 homozygotes (embryonic or early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGAGGATAGTTTGCAGGAG. External right primer: CTCTTCCCCTCCGATACCTC. Internal left primer: AGCTGCAGTCAGAAGTGGGT. Internal right primer: AATCCCAGTTTCTCGCCTTT. Internal WT amplicon: 2753 bp. Deletion size: 1273 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C34D1.2. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1712 homozygotes (probable early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: AGTAAAAGCGTTTCAGGCGA. External right primer: CATGCGAGAGTACTGGACGA. Internal left primer: AATTACTTGGCTGGCGAAAA. Internal right primer: TGGAACCACTGGAAATGACA. Internal WT amplicon: 2173 bp. Deletion size: 1133 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K08F11.3. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1715 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTTCATGGACGTTGTTGTGC. External right primer: GCATTTCTCCTTTTTGCTCG. Internal left primer: TTTGCTTCAGATTTGCGATG. Internal right primer: TTTCAGATGGCTGACACTCG. Internal WT amplicon: 3347 bp. Deletion size: 773 bp. Deletion left flank: GCAGCCTGATCAACTCTCTGATCAACAAGA. Deletion right flank: GTTTCCACATGATATATTCAATTTTTTGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

K03B4.3, K03B4.2. Homozygous sterile deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1719 homozygotes (scrawny sterile adult with glassy appearance). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CGGCAAATTGTGGTTTTTCT. External right primer: GAAAAGTGTGGAACAGGGGA. Internal left primer: CTATTTTCGGGATTTTGGCA. Internal right primer: AACCTCTTGGCCTCCGTAGT. Internal WT amplicon: 2562 bp. Deletion size: 1311 bp. Deletion left flank: CGAAAACGCGCGCCGCACATTGCAAGTGGG. Deletion right flank: ATCGCAACCGTCCCCCGTTCCAAGTGTGGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

H19N07.4. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP ok1668 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Outer Left Sequence: GGTCTTGAACGGGAGCATAA. Outer Right Sequence: ACCTTCGATGATCGGATTGA. Inner Left Sequence: ACGGTTTGGTTTTGAACTGC. Inner Right Sequence: TCAAGAATTGGCGTGAAGTG. Inner Primer WT PCR Product: 2552. Deletion size: 826 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807