MT15109 |
C. elegans |
lin-54(n3423) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+ and segregate Ste GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background.
|
|
MT15537 |
C. elegans |
unc-30(e191) lin-54(n3423) IV/nT1 [qIs51] (IV;V); lin-15A(n767) X. Show Description
Heterozygotes are Muv and GFP+ and segregate SteUncMuv GFP- and dead eggs. n3423 is PVul and sterile when alone; Muv in synMuv class A background.
|
|
MT17143 |
C. elegans |
nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X. Show Description
Heterozygote. [NOTE: (11/14/2018) This strain was originally described as carrying mir-52(n4114), but the allele is actually n4100.] Reference: Curr Bio (2010) 20:367-73.
|
|
MT1821 |
C. elegans |
lin-25(e1446) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Hets are Unc and segregate Unc, Vul and dead eggs. Maintain by picking Uncs.
|
|
MT18690 |
C. elegans |
sfa-1(n5223) IV/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP sfa-1 homozygotes (arrest L1-L2 stage). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Ma & Horvitz (2009) PLoS 5(11):e1000708.
|
|
MT2115 |
C. elegans |
nDf27/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and dead eggs. Maintain by picking WT.
|
|
MT4628 |
C. elegans |
nDf27 IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT and dead eggs.
|
|
MT4629 |
C. elegans |
mars-1(s254) unc-22(s7) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, Lethal Twitchers and dead eggs. Lethal mid-larval; some twitchers make it to almost adults but are always sterile. Maintain by picking WT.
|
|
MT5499 |
C. elegans |
let-60(n1876) unc-22(s7) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, Lethal twitchers and dead eggs.
|
|
MT5734 |
C. elegans |
nDf41 IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Unc. nDf41 is homozygous lethal. Throws dead eggs.
|
|
MT5748 |
C. elegans |
let-60(n2022) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
|
|
MT5749 |
C. elegans |
let-60(n2034) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, Vul and dead eggs.
|
|
MT5750 |
C. elegans |
let-60(n2035) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
|
|
MT5813 |
C. elegans |
nDf42 V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs and dead eggs.
|
|
MT8256 |
C. elegans |
lin-1(n304) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, Muvs and dead eggs.
|
|
MT8384 |
C. elegans |
lin-1(sy254) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, Muv and dead eggs.
|
|
MT8998 |
C. elegans |
unc-24(e138) sqv-1(n2819) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, SqvUncs and dead eggs. n2819: mid-L4 vulva abnormal, sterile.
|
|
MT8999 |
C. elegans |
unc-42(e270) sqv-4(n2827) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Hets are Unc (n754) and segregate Unc (n754), Unc(e270)Sqv and dead eggs. n2827: mid-L4 vulva abnormal, sterile.
|
|
MT9352 |
C. elegans |
sqv-6(n2845) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, Steriles and dead eggs. n2845: mid-L4 vulva abnormal, sterile.
|
|
MU1255 |
C. elegans |
nhr-67(tm2217) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2217 homozygotes (arrested L1 larvae). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
|
|
MU1269 |
C. elegans |
nhr-67(pf88) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. Pick GFP+ to maintain -- viable pf88 homozygotes (Pvl Egl) can overtake the balanced population. nT1[qIs51] is homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Reference: Verghese E, et al. Dev Biol. 2011 Aug 15;356(2):516-28.
|
|
NB327 |
C. elegans |
ints-6(tm1615) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested nT1 aneuploids, and non-GFP dic-1 homozygotes. dic-1(tm1615) homozygotes arrest at the L3 larval stage. ints-6 previously known as dic-1.
|
|
NF963 |
C. elegans |
fbl-1(tk45) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. nT1[qIs51] is probably homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. fbl-1(tk45) homozygotes are Dpy, Sterile and are Distal Tip migration defective.
|
|
NOB142 |
C. elegans |
daf-2(e1370) III; isp-1(qm150) IV/nT1[qIs51] (IV;V). Show Description
Maintain at 15-20C: will form dauers at higher temps. Slow growing. Pick GFP+ to maintain. Heterozygotes are GFP+ and segregate WT GFP+ hets, arrested nT1[qIs51] aneuploids, and non-GFP daf-2(e1370); isp-1(qm150) homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. [NOTE: Originally published daf-2(e1370); isp-1(qm150) strain MQ876 was found to not actually contain the daf-2(e1370) mutation. This strain was made to study the double mutant and revealed that daf-2(e1370); isp-1(qm150) homozygotes are inviable/sterile.] Reference: Cooper et al. In preparation.
|
|
NW1675 |
C. elegans |
mig-6(oz113) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are wild-type and GFP+. Heterozygotes segregate WT GFP+, sterile GFP- homozygotes, and dead eggs. Maintain by picking GFP+ wild-type.
|
|
OCF12 |
C. elegans |
lpin-1(ok2761) V/nT1 [qIs51] (IV;V). Show Description
Heterzygotes are wildtype and GFP+. lpin-1(ok2761) homozygotes die as L1 larvae. Homozygous nT1[qIs51] inviable.
|
|
OD2174 |
C. elegans |
unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V). Show Description
CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
|
|
OD3737 |
C. elegans |
cyb-3(lt110) V/nT1 [qIs51] (IV;V). Show Description
CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
|
|
PD8292 |
C. elegans |
ceh-22(cc8266) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs, non-Uncs and dead eggs.
|
|
PS4627 |
C. elegans |
let-60&sf1=all">let-60(n1046) unc-31(e169) V/nT1 [let(m435)] (IV;V). Show Description
Maintain by picking WT. Segregates Muv Unc (let-60 unc-31 homozygotes), wild-type heterozygotes and dead eggs. Reference: Moghal N, Sternberg PW. Development. 2003 Jan;130(1):57-69.
|
|
PS524 |
C. elegans |
let-60(sy100) dpy-20(e1282) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are non-Dpy Vul and segregate non-Dpy Vul, DpyVul whose progeny are dead, and dead eggs. sy100 is dominant Vul and recessive Lethal with maternal rescue: homozygotes from heterozygous mothers grow to adulthood and become a bag of dead larvae. sy100 is not 100% penetrant. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS536 |
C. elegans |
unc-24(e138) let-60(sy99) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are Vul (97% Egl). Segregates dead eggs. sy99 homozygotes are lethal. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
PS538 |
C. elegans |
unc-24(e138) let-60(sy92) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are Vul and segregate Vul, Unc-24 lethals and dead eggs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
RA520 |
C. elegans |
swsn-4(tm305) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are mostly wild-type GFP+, but occasionally have missing gonad arms. Pick wild-type GFP+ to maintain. Heterozygotes segregate wild-type GFP+, GFP- tm305 homozygotes (embryonic lethal) and arrested nT1 aneuploids. Reference: Large EE and Mathies LD (2014 Jan 8). G3, doi: 10.1534/g3.113.009852.
|
|
RB1143 |
C. elegans |
F36D4.2(ok1128) V/nT1 [qIs51] (IV;V). Show Description
F36D4.2 Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1 aneuploids, and non-GFP ok1128 homozygotes. nT1[qIs51] homozygotes inviable. Outer Left Sequence: agtcatgaacagatccccca. Outer Right Sequence: attgcttggacgagaggaga. Inner Left Sequence: tgcttttattcgcacccagt. Inner Right Sequence: tggatctgcaagtccatctg. Inner Primer PCR Length: 2151. Estimated Deletion Size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1217 |
C. elegans |
F25G6.2(ok1233) V/nT1 [qIs51] (IV;V). Show Description
F25G6.2 Heterozygotes are WT and GFP+ in the pharynx. ok1233 homozygotes arrest at the L1 stage. Outer Left Sequence: TGAACTCACGAAAATGACGG. Outer Right Sequence: ATACAGGTTCCAATGAGCGG. Inner Left Sequence: CTCGGTGCACGAAGTGTAAA. Inner Right Sequence: GCCAAAAAGGAATTGCAAAA. Inner Primer PCR Length: 3056. Estimated Deletion Size: about 2000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1221 |
C. elegans |
his-74(ok1219) V/nT1 [qIs51] (IV;V). Show Description
W05B10.1 Heterozygotes are WT and GFP+. Outer Left Sequence: ttggcttatcggacagatcc. Outer Right Sequence: gtgagctcgtaatatccggc. Inner Left Sequence: aaaatgagaattgatcgcgg. Inner Right Sequence: accttgtgtgatttgcgatg. Inner Primer PCR Length: 2255. Estimated Deletion Size: about 1400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1223 |
C. elegans |
sph-1(ok1199) IV/nT1 [qIs51] (IV;V). Show Description
F42G8.10 Heterozygotes are WT and GFP+. Outer Left Sequence: aaagtgaacagcaggccaac. Outer Right Sequence: attgtccatcccatcgaaga. Inner Left Sequence: aggaaaccatggctttaggc. Inner Right Sequence: gcttgtgctttcgactttcc. Inner Primer PCR Length: 2101. Estimated Deletion Size: about 1350 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1225 |
C. elegans |
pxf-1(ok1186) IV/nT1 [qIs51] (IV;V). Show Description
T14G10.2a Heterozygotes are WT and GFP+. Outer Left Sequence: ttgaaatttcgaagatcccg. Outer Right Sequence: catgcccgattatctccact. Inner Left Sequence: acccaccacatttcacgatt. Inner Right Sequence: ttcgattgaccctcatctcc. Inner Primer PCR Length: 3196. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1228 |
C. elegans |
arx-2(ok1269) V/nT1 [qIs51] (IV;V). Show Description
K07C5.1 Heterozygotes are WT and GFP+. Outer Left Sequence: tccaatttggcttcaacaca. Outer Right Sequence: catcgacttccgcgtatttt. Inner Left Sequence: tttgaatgagagtgggggag. Inner Right Sequence: ttttcaggcgaaatggattc. Inner Primer PCR Length: 2734. Estimated Deletion Size: about 1300 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1235 |
C. elegans |
T28C6.1(ok1264) IV/nT1 [qIs51] (IV;V). Show Description
T28C6.1 Heterozygotes are WT and GFP+. Maintain by picking GFP+ worms as the balancer may break down. ok1264 animals are homozygous viable. Outer Left Sequence: TCCCTGTTCCATTTTTGAGC. Outer Right Sequence: CATCACCTCTACCACCCCAT. Inner Left Sequence: AAGCCAAGAATTCGCAAAAA. Inner Right Sequence: CAACACCACCATGACCTGAA. Inner Primer PCR Length: 2241. Estimated Deletion Size: about 1500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1246 |
C. elegans |
nxf-1(ok1281) V/nT1 [qIs51] (IV;V). Show Description
C15H11.3 Heterozygotes are WT and GFP+. ok1281 animals arrest as larvae. Outer Left Sequence: gagcttctgcaggacacaca. Outer Right Sequence: ctgcgaagatgggaaaagag. Inner Left Sequence: tgaaaagctcagtgacggtg. Inner Right Sequence: ctcgtctgcatttttgcgta. Inner Primer PCR Length: 3153. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1276 |
C. elegans |
sun-1(ok1282) V/nT1 [qIs51] (IV;V). Show Description
F57B1.2 Heterozygotes are WT and GFP+. Outer Left Sequence: tgattcccaggaaccaaaaa. Outer Right Sequence: tctgtgcctgccaaatcata. Inner Left Sequence: aaaacgaaaacggcactttg. Inner Right Sequence: aattacaattccgcacaggc. Inner Primer PCR Length: 2136. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1277 |
C. elegans |
gcy-6(ok1293) V/nT1 [qIs51] (IV;V). Show Description
B0024.6 Heterozygotes are WT and GFP+. ok1293 animals arrest in the larval stage. Outer Left Sequence: agggagagggataaggggtt. Outer Right Sequence: tgcaatgccagttttcattc. Inner Left Sequence: gtccgccaaggatttaacaa. Inner Right Sequence: gggggataacttcatcagca. Inner Primer PCR Length: 3239. Estimated Deletion Size: about 1600 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB1280 |
C. elegans |
F15B9.4(ok1296) V/nT1 [qIs51] (IV;V). Show Description
F15B9.4 Heterozygotes are WT and GFP+. Outer Left Sequence: gactcaaggcgattgctgat. Outer Right Sequence: tgacgcggtaataaatgcaa. Inner Left Sequence: cgatcgttcccctcaaagta. Inner Right Sequence: ttcttgttgcgatgaagtcg. Inner Primer PCR Length: 3243. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RG3034 |
C. elegans |
+/nT1[umnIs49] IV; C37C3.7(ve534[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, Mig. Deletion of 1217 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste Mig GFP+ non-mKate2 (ve534 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GAAGTCGATGCCGTTCTGCAGTATCCTTCA ; Right flanking sequence: TACAATGACAAATCCCTCCAGCATAGATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3039 |
C. elegans |
spe-36(ve539[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V. Show Description
F40F11.4. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, lays only oocytes. Deletion of 2632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate2 (ve539 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcacaaaaactcacAAATAACTTTGTACCG ; Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAATACATA. sgRNA #1: acAAATAACTTTGTACCGGG; sgRNA #2: CTTCATAGCTCTTGCGTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3040 |
C. elegans |
+/nT1 [umnIs49] IV; F58H1.6(ve540[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste with a few escapers. Deletion of 1527 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Sterile GFP+ non-mKate2 (ve540 homozygotes, some escapers will lay broods), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aagtccgagataaataatctacatcctcat ; Right flanking sequence: TATCCAAGAAACACAGATTGGGATTGCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3046 |
C. elegans |
C46G7.1(ve546[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 1523 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, larval lethal GFP+ non-mKate2 (ve546 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes), and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caatacaatttacaggtaaaagccggcaac ; Right flanking sequence: ATCGGAATTGCAGTTCTTCTTTCACTTCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3062 |
C. elegans |
C05C8.7(ve562[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 [umnIs49] IV; +/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Emb. Deletion of 3553 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (ve562 homozygotes and aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: attgaaaaaagtgttggtattaccccgtaa ; Right flanking sequence: TATGGTGTCTTCTGATCAATTTGGAAACTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|