CGC63 |
C. elegans |
unc-5(e53)/nT1 [umnIs49] IV; dpy-11(e224)/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
CGC71 |
C. elegans |
unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs57] V. Show Description
umnIs57 [myo-2p::mKate2 + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
CL6180 |
C. elegans |
smg-1(cc546) I; dvIs19 III; skn-1(zu67)/nT1 [unc-?(n754) let-?] (IV;V); dvIs27 X. Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Roller with weak constitutive GFP expression. Balanced strain, segregates Rol Uncs [skn-1(zu67) heterozygotes], Rol nonUncs [skn-1(zu67) homozygotes] and dead eggs. Maintain by picking Rol Uncs. Paralyzed if upshifted as larvae to 25C. References: Dostal, V and Link CD (2010) J Vis Exp. Oct 9;(44). Dostal V, Roberts CM, Link CD (2010) Genetics Nov;186(3):857-66. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]
|
|
CL691 |
C. elegans |
dvIs19 III; skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Segregates Unc skn-1(zu67) heterozygotes, arrested eggs/larvae (nT1 homozygotes), and wild type skn-1(zu67) homozygotes (sterile). All genotypes show constitutive weak GFP expression. Upon exposure to SKN-1 inducers (e.g., azide), strong induction of GFP is observered in skn-1/+ hets; there is no induction in skn-1 homozygotes. Pick Uncs to maintain -- although this strain is nominally balanced, nT1 can break down. Reference: Dostal, V., et al. Genetics. 2010 Nov;186(3):857-66.
|
|
CV199 |
C. elegans |
fan-1(tm423) IV/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP fan-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Smogorzewska A, et al. (2010) Molec Cell 39:36-47.
|
|
CZ18637 |
C. elegans |
juSi83 II; rps-18(ok3353) IV/nT1[qIs51] (IV;V). Show Description
juSi83 [GFP::rps-18 + Cbr-unc-119(+)] II. Homozygous lethal mutation balanced by GFP-marked translocation. Heterozygotes are WT GFP+ and segregate WT GFP+, Vul and dead eggs. Non-conditonal GFP-tagged ribosomes; array over-expressing N-terminally tagged rps-18 (small ribosomal subunit) partially rescues rps-18(ok3353) larval arrest (some animals will escape L1 arrest and develop to L3 stage). Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
|
|
CZ26660 |
C elegans |
micu-1(ju1155) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP micu-1 homozygotes. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Tang NH, et al. Curr Biol. 2020 Jan 15. pii: S0960-9822(19)31694-X. doi: 10.1016/j.cub.2019.12.061.
|
|
DA1042 |
C. elegans |
egl-19(ad1008) unc-24(e138) IV/nT1 [unc-?(n754) let-?] (IV;V) Show Description
Heterozygotes are Unc and segregate Uncs and dead eggs. ad1008 homozygotes are Pat.
|
|
DA496 |
C. elegans |
sDf10 unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Unc lethals (early larval) and dead eggs. Maintain by picking WT.
|
|
DA497 |
C. elegans |
let-59(s49) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and lethal twitchers. Lethal early larval. Pick twitchers in 1% nicotine.
|
|
DA709 |
C. elegans |
+/nT1 IV; sqt-3(sc63) eat-6(ad467) unc-76(e911)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and Sqt Unc larvae that grow very slowly.
|
|
DR1056 |
C. elegans |
unc-42(e270) ama-2(m323) V/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT and dead eggs. (Chromosome carrying unc-42 ama-2 is homozygous lethal.) Strain is resistant to _-amanitin.
|
|
DR1172 |
C. elegans |
let-60(s59) unc-22(s7) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, Lethal Twitchers, and dead eggs. Lethal mid-larval (leaky). Maintain by picking WT. Heterozygotes twitch in 1% nicotine.
|
|
DR1215 |
C. elegans |
unc-22(s7) let-67(s214) IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, dead eggs and Twitchers that arrest as larvae. Maintain by picking WT. Hets twitch in 1% nicotine.
|
|
DR520 |
C. elegans |
sDf9/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, and lethals. Lethal early larval. Heterozygotes twitch in 1% nicotine. Well balanced.
|
|
DR561 |
C. elegans |
sDf8/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and lethals. Lethal early larval. Heterozygotes twitch in 1% nicotine.
|
|
DR641 |
C. elegans |
ama-1(m118m221) unc-8(e15)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Unc and segregate semi-Unc and Vul and dead eggs. (Does not segregate Unc homozygotes because linked to the unc is a lethal in the amanitin gene.)
|
|
DR682 |
C. elegans |
dpy-13(e184) ama-1(m118m235) IV/nT1 [qIs51] (IV;V). Show Description
Temperature sensitive. Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in mid-larval stages at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
|
|
DR683 |
C. elegans |
dpy-13(e184) ama-1(m118m236)/nT1 IV; +/nT1 V. Show Description
Temperature sensitive . Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead eggs and Dpys. Dpys are sterile adults at 15C and 20C. Dpys are early larval lethals at 25C.
|
|
DR684 |
C. elegans |
mDf9/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and dead eggs. Homozygous Df is embryonic lethal. Strain is sensitive to alpha-amanitin. New stock received from Patrice Albert 12/95. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
|
|
DR685 |
C. elegans |
dpy-13(e184) ama-1(m118m238)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Dpy and dead eggs. Dpys produce progeny at 15C and 20C, but are sterile at 25C. Strain is sensitive to alpha-amanitin.
|
|
DR697 |
C. elegans |
cha-1(m324) dpy-13(e184) ama-1(m118)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul and Lethals.
|
|
DR699 |
C. elegans |
dpy-13(e184) ama-1(m118m252)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are Dpy and segregate Dpy, Vul and dead eggs. Homozygous dpy-13 ama-1 animals are embryonic lethals. Strain is sensitive to alpha-amanitin.
|
|
DR732 |
C. elegans |
daf-15(m81) unc-22(s7)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, Twitchers which are dauers (dauer constitutive) and dead eggs. Maintain by picking WT. Hets twitch in 1% nicotine.
|
|
DR787 |
C. elegans |
dpy-13(e184) ama-1(m118) let-276(m240)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, DpyLet and dead eggs. Lethal early larval. Maintain by picking semi-Dpy.
|
|
DR789 |
C. elegans |
dpy-13(e184) IV/nT1 [let-?(m435)] (IV;V); unc-42(e270) V/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. Maintain by picking WT.
|
|
DR792 |
C. elegans |
sDf2/nT1 IV; +/nT1 V. Show Description
Hets are WT and segregate WT, dead eggs and Vul (nT1/nT1). Clone WT to maintain. Well balanced. The nT1 homozygotes may overtake the plate at 15C or upon starvation.
|
|
DR793 |
C. elegans |
dpy-13(e184) mDf7 IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy and dead eggs (mDf7/mDf7, nT1/nT1 and aneuploids). This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle. Rec'd new stock 11/99 from Riddle lab.
|
|
DR795 |
C. elegans |
dpy-13(e184) ama-1(m118) let-276(m239)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, and dead eggs. Homozygous let-276 are dead eggs. Maintain by picking semi-Dpy.
|
|
DR799 |
C. elegans |
mDf4/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
|
|
DR802 |
C. elegans |
mDf5/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
|
|
DR803 |
C. elegans |
mDf6/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle. Rec'd new stock 12/99 from Riddle lab.
|
|
DR806 |
C. elegans |
dpy-13(e184) ama-1(m118m328)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, DpyLet and dead eggs. Lethal early larval (L1) at 20C and 25C. Maintain by picking WT.
|
|
DR811 |
C. elegans |
dpy-13(e184) ama-1(m118m332) IV/nT1 [qIs51] (IV;V). Show Description
Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in L1 stage at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
|
|
DR814 |
C. elegans |
dpy-13(e184) ama-1(m118) mDf8 IV/nT1 [let-?(m435)] (IV;V). Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, early larval lethals and dead eggs. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
|
|
DR877 |
C. elegans |
dpy-13(e184) ama-1(m118m367) IV/nT1 [qIs51] (IV;V). Show Description
Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in L1 stage at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
|
|
DR880 |
C. elegans |
dpy-13(e184) ama-1(m118m370) IV/nT1 [qIs51] (IV;V). Show Description
Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny arrest in L1 stage at >20C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
|
|
DR892 |
C. elegans |
dpy-13(e184) ama-1(m118m396) IV/nT1 [qIs51] (IV;V). Show Description
Temperature sensitive. Sensitive to alpha-amanitin. Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, dead embryos, and Dpy. Dpy progeny are maternal effect Emb at 20C and arrest in mid-larval stages at 25C. Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.Reference: Bowman EA, Riddle DR, Kelly WG. G3 November 2011 1:411-416.
|
|
DR918 |
C. elegans |
mDf10/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, early larval lethals and dead eggs. Maintain by picking semi-Dpy. This strain was generated by the Genetic Toolkit project, which should be acknowledged in any publications resulting from its use: The Genetic Toolkit is funded by the NIH National Center for Research Resources (NCRR) (USA) to Ann M. Rose, David L. Baillie, and Donald L. Riddle. Report all experimental results to Don Riddle.
|
|
DR942 |
C. elegans |
let-278(m265) dpy-13(e184) ama-1(m118)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are semi-Dpy and segregate semi-Dpy, Vul, DpyLet and dead eggs. The DpyLets are Sterile adults. Maintain by picking semi-Dpy.
|
|
DW101 |
C. elegans |
atl-1(tm853) V/nT1 [unc-?(n754) let-? qIs50] (IV;V). Show Description
Heterozygotes are Unc and GFP+ with signal in the pharynx. atl-1(tm853) homozygotes are non-Unc, viable, GFP-, and produce 100% dead embryos. qIs50 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter (F22B7.9) driving GFP in the intestine. nT1[unc-?(n754) let-? qIs50] is also known as DnT1[qIs50]. qIs50 is apparently inserted on DnT1. qIs50 is somewhat dimmer than the similar qIs51.
|
|
EJ521 |
C. elegans |
lin-45(dx19) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, non-Unc Steriles, larval lethals and dead eggs. dx19 is a strong lin-45 raf allele: dx19 homozygotes from dx19/+ heterozygous parents are 13% larval lethal and among the adults, 100% are Sterile and Vul.
|
|
EKM11 |
C. elegans |
htz-1(tm2469) IV/nT1 [qIs51] (IV;V). Show Description
Maintain under normal condition. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2469 homozygotes (Sterile). tm2469 m+z- are sterile adults. Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Petty EL, et al. PLoS Genet. 2009 Oct;5(10):e1000699. doi: 10.1371/journal.pgen.1000699. Csankovszki G, et al. (2009) Curr Biol 19(1):9-19. [NOTE: new stock received at CGC 05/26/2021. Original stock received in 2010 had broken down and was no longer segregating as expected.]
|
|
EL129 |
C. elegans |
ego-3(om40) unc-76(e911) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate additional hets, Unc-76 om40 homozygotes and dead eggs. om40 animals have multiple germline defects.
|
|
EU1 |
C. elegans |
skn-1(zu67) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.
|
|
EU139 |
C. elegans |
skn-1(or12) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc. Received new stock 11/2002.
|
|
EU1424 |
C. elegans |
mom-2(or77) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
mom-2(or77) is a recessive, non-conditional maternal-effect embryonic lethal. Weak allele of mom-2/Wnt (splice acceptor mutation in last exon (exon6). 8% of mutant embryos lack gut. Heterozygotes are Unc.
|
|
EU143 |
C. elegans |
skn-1(or13) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Maintain by picking Unc.
|
|
EU148 |
C. elegans |
apx-1(or15) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc and wild type animals which give only dead progeny.
|
|
EU16 |
C. elegans |
dpy-18(e364) pie-1(zu154) III; skn-1(zu67)/nT1 [unc-?(n754) let-?] IV; +/nT1 V; eDp6 (III;f). Show Description
Heterozygotes are Unc. Segregates Uncs (dpy-18 pie-1; skn-1/DnT1; eDp6), Dpy non-Uncs (dpy-18 pie-1; skn-1 with no Dp) which give only dead embryos, and DpyUncs (dpy-18 pie-1; skn-1/DnT1 with no Dp) which give only dead eggs, WT looking (dpy-18 pie-1; skn-1; eDp6) which give only dead embryos, and dead eggs.
|
|