More Fields
Strain Species Genotype
BC11129 C. elegans dpy-5(e907) I; sEx11129. Show Description
sEx11129 [rCesF41E7.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12792 C. elegans dpy-5(e907) I; sIs12792. Show Description
sIs12792[rCesF41E7.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12693 C. elegans dpy-5(e907) I; sIs12693. Show Description
sIs12693 [rCesF41E7.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
PS8902 C. elegans npr-6(sy1571) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-6. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: gtaatttttattttaaaaaaacacgtttcagAACC right flanking sequence: CCATGGAAATGGAATATTTCCGCCCATTCTTTATTTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACACGTTTCAGAACCCCA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616