| HBR2317 |
C. elegans |
nlp-8(syb762) IV. Show Description
syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| VC1309 |
C. elegans |
nlp-8(ok1799) I. Show Description
D2005.2. Superficially wild type. External left primer: TCGGAAATGATTCATAGGGC. External right primer: TCACACCTCATACCCCCATT. Internal left primer: CTTTCAAATCACCCGACCAT. Internal right primer: TTCTTGATCTACCCGAACCG. Internal WT amplicon: 2229 bp. Deletion size: 695 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| PHX1446 |
C. elegans |
nlp-8(syb762) I; nlp-32(syb431) cnc- 6(syb393) III, Y43C5A.3(syb761) IV; sybDf2 sybDf1 cnc-10(syb937) nlp-25(syb579) cnc-7(syb558) V. Show Description
Reduced survival after wounding. PHX1446 carries knockouts of 19 members of the nlp and cnc peptide families. sybDf1 is a deletion of a gene cassette including nlp-34, nlp-31, nlp-30, nlp-29, nlp-28, and nlp-27. sybDf2 is a deletion of a gene cassette including cnc-11, cnc-1, cnc-5, cnc-4, cnc-3, and cnc-2. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791
|
|
| PS9594 |
C. elegans |
nlp-8(sy1844) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gttttcagTGCCTTCTTATCGGCTTTACTGCCGCCT. Right flanking sequence: ACCCCTACCTGATCTTTCCTGCTTCACCGTCCTCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAAGATCAGGTAGGGGTAGG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
| OH15655 |
C. elegans |
otIs711. Show Description
otIs711 [nlp-8p::GFP + lin-15(+)]. Reference: Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
|
|
| PHX4399 |
C. elegans |
nlp-82(syb4399[nlp-82::SL2::GFP::H2B]) II. Show Description
GFP tag inserted at the C-terminus of the endogenous nlp-82 locus by CRISPR. Allele generated by SUNY Biotech. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
| PS8307 |
C. elegans |
nlp-80(sy1264) V. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-80;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: CTTCTCTTGTGTATTCTGTTTGCTTTATCCGAAG
Right flanking sequence: CTTACAGTCGCATGGAGTTGGAgtaagttaagaac
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTCCATGCGACTGTAAGCTT
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
| PS8311 |
C. elegans |
nlp-82(sy1266) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-82;
Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).
Left flanking sequence: cattttccaactataaattttacagATGCCGTCA
Right flanking sequence: TACCACACTGTAATCATCATCCTGCTCATCTCAAT
inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATGATTACAGTGTGGTATGA
Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|