1450 bp deletion. Deletion removes 245 bp of promoter, 1st exon and 2nd exon.

ZK20.6. External left primer: CTTGGCTCCACACCAAACTT. External right primer: GGAGTGGGCTCAGATTCTTG. Internal left primer: ATCCAACGAAGAAGAGCTGC. Internal right primer: CAACCACTCCATTCCTGGTT. Internal WT amplicon: 1137 bp. Deletion size: 443 bp. Deletion left flank: AACTGCACCAATTCCTCCGTAGTTGAGAGC. Deletion right flank: CTGAAATTTAGTTAAAAGTTAAATAGTGTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Deletion of 2722 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATATCTTCGAATCTCTCATCCAAGTACCT ; Right flanking sequence: TTTCACTGATAGTTATCAGTTGCATCTGAC. sgRNA #1: GAGTTGTCCAGTCAAACGTG; sgRNA #2: ATAGTGATATACCTACTCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

wbmIs131 [nep-17p::3XFLAG::rpl-22::SL2::wrmScarlet::unc-54 3'UTR, *wbmIs119] V. N-terminal 3x flag tagged RPL-22 ribosomal subunit expressed in the intestine. wrmScarlet expression in the intestine. Can be used for Single-copy Knock-In Translating Ribosome Immunoprecipitation (SKI TRIP) experiments. Derived by modification of wbmIs119. Reference: Wester LE, et al. Cell Rep. Methods 2023 3, 100433. 10.1016/j.crmeth.2023.100433