oxTi1009 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-18.96). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1010 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:10.79). Insertion into tbc-17. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1011 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] II. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (II:-1.99). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1014 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.62). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1015 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:12.63). Insertion into srd-50. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1016 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:-18.09). Insertion into Y95B8A.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1017 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:3.20). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1018 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:21.64). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1019 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] X. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (X:-7.36). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1020 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:-2.60). Insertion into C04F5.2. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1021 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] V. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (V:6.85). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1022 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] I. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (I:22.34). Insertion into Y71A12B.8. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1023 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] IV. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (IV:4.05). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

oxTi1024 [eft-3p::GFP::2xNLS::tbb-2 3'UTR + NeoR] III. Strain is healthy. NOTE: This strain is not necessarily homozygous - please verify before using. Nuclear green fluorescence is broadly expressed (in most cells) and visible under dissection microscope. This strain can be used for mapping or to facilitate genetic crosses. Integration site: (III:-3.80). Intergenic insertion. Please see wormbuilder.org for exact insertion site. miniMos insertion of pCFJ1659 into N2 with neomycin selection.

umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. or1985 is a CRISPR/Cas9 engineered deletion of zyg-9 removing the entire open reading frame. Heterozygotes are wild-type and GFP+ and segregate WT GFP+ (hets), or1948 homozygotes (GFP-, lay 100% dead embryos) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115

arTi85 [lin-31p::ERK::KTR::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi85 transgene is a single-copy transposon insertion expressing a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.

arTi101 [lin-31p::ERK::KTR(S43A, T55A, S62A)::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi101 transgene is a single-copy transposon insertion expressing a mutant, unphosphorylated form of a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Use arTi101 as a negative control for transgene arTi85. Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.

arTi361 [rps-27p::GFP(lox2272-flexon-lox2272)::H2B::unc-54 3'UTR + NeoR] I (-12.74). First intron of GFP is replaced with a Flexon containing two lox2272 sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Transgene maps to -12.74 (I). Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology.

arTi452 [rps-27p::GFP(LoxP-flexon-LoxP)::H2B::unc-54 3'UTR + NeoR] I (-4.81). First intron of GFP is replaced with a Flexon containing two loxP sites. GFP::H2B is expressed at a high level in lineages where Cre is expressed with a second transgene. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.

arTi461 [rps-27p::GFP(FRT-flexon-FRT)::H2B::unc-54 3'UTR + NeoR] I (-3.80). The first intron of GFP was replaced with a Flexon containing two FRT sites. GFP::H2B is expressed at a high level in lineages where Flp recombiase is expressed with a second transgene. Flexon contains two FRT sites. Reference: Wittes J & Greenwald I. (2024). New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans. microPublication Biology. 10.17912/micropub.biology.001315.

ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. osIs182 [eft-3p::AtTIR1(F79G) + LoxP + myo-2p::GFP + rps-27p::neoR + LoxP] V. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing degron::GFP in the soma. osIs182 is a single copy insertion of TIR1(F79G) into chromosome V (oxTi365) and expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.

ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi592 [spd-2p::gfp::spd-5(S653A S658A, re-encoded) + Cbr-unc-119(+)] II. Small centrosomes. mCherry-labeled gamma tubulin. GFP-labeled centrioles. Derived by crossing parental strains OD1801 with OD1709. Reference: Woodruff JB, et al. Science. 2015 May 15;348(6236):808-12. doi: 10.1126/science.aaa3923. PMID: 25977552

ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi1141 [spd-2p::gfp::spd-5(re-encoded) + Cbr-unc-119(+)] II. Re-encoded spd-5 is siRNA-resistant. mCherry-labeled gamma tubulin. GFP-labeled centrioles. Reference: Woodruff JB, et al. Science. 2015 May 15;348(6236):808-12. doi: 10.1126/science.aaa3923. PMID: 25977552

ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi1539 [spd-2p::GFP::spd-5 S170A T178A T198A::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled microtubules. GFP-labeled centrosomes. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

kyIs140: [str-2::GFP + lin-15(+)] I. otTi20 [oig-8p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing oig-8p::oig-8 transgene.

kyIs140: [str-2::GFP + lin-15(+)] I. otTi22 [str-1p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing str-1p::oig-8 transgene.

kyIs140: [str-2::GFP + lin-15(+)] I. otTi24 [ceh-36(prom3)::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing ceh-36(prom3)::oig-8 transgene.

Bacteria. OP50 transformed with pETMCN-EK (derived from pET-28b: Ori colE1, KanR) Kan-resistant plasmid. Resistant to Kanamycin, Neomycin, G418. Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22. Biosafety Level: BSL-1.

ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.

ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs27 [myo-2::GFP + NeoR, III: 8856215 (intergenic)] III. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.

oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)] II. ccTi1594 [mex-5p::GFP::gpr-1::smu-1 3'UTR + Cbr-unc-119(+), III: 680195] III. umnIs7 [myo-2p::GFP + NeoR, III:9421936] III. mCherry expression in pharyngeal and body wall muscle nuclei. GFP expression in germline and GFP expression in pharynx. High penetrance of non-Mendelian inheritance. Neomycin resistant. The GPR-1 overexpression transgene consistently confers a high penetrance of non-Mendelian inheritance; fluorescent markers allow tracking of Mendelian and non-Mendelian events. The genomic location of ccTi1594 is with respect to the WEBcel235 assembly.

syTi1 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3'] X. Mapped by Inverse PCR to Chromosome X: (13709433-13709434).

syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974).

umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim mKate2 expression in pharynx, and segregate heterozygotes (not paralyzed, dim mKate2), homozygous wild-type (not paralyzed, no mKate2), and hIn1 homozygotes (paralyzed, bright mKate2). Pick non-paralyzed, dim mKate2 worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived by crossing parental strain CGC105 (hIn1[umnIs78]) to RG3173 (Y40B1B.7(ve673[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hIn1[unc-54(h1040)]) and selecting for the recombined hIn1 worms.

umnIs75 [myo-2p::GFP + NeoR, I: 12541645 (intergenic)] I. Heterozygous strain. Crossover suppressor for LGI right. Inversion includes unc-75 and unc-54(h1040). Heterozygotes are wild-type (not paralyzed) with dim GFP expression in pharynx, and segregate heterozygotes (not paralyzed, dim GFP), homozygous wild-type (not paralyzed, no GFP), and hIn1 homozygotes (paralyzed, bright GFP). Pick non-paralyzed, dim GFP worms and check for correct segregation of progeny to maintain. Maintain at 20C or higher: recombined balancer seems more prone to breaking down at low temperatures. Derived cross of parental strains CGC94 (hIn1[umnIs75]) to QP2460 (hIn1[umnIs78, unc-54(h1040)]/+) and selecting for the recombined hIn1 worms.

Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acggcatttactcacagaaaatgggaatat ; Right flanking sequence: cgcttcaaagtttgtaatttgaaatttgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cagcgtgagaaaaatatcagaatgtgatcg ; Right flanking sequence: gtgggagattctatcaagagaattcactga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

unc, dpy, rol, slight egl, pvl. Deletion of 1258 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tatccaatatcctacatcctatatcctcgt ; Right flanking sequence: attggaaaaatacgagacgatcgatgaaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agtattcactctttgttgtctttaccgaca ; Right flanking sequence: GCAAAAGGTTTTTGGTACAAAATGGAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1413 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGTCGAAAGCTTAAGATGCGCTTCCGAAG ; Right flanking sequence: ctatcaatcctccttctttattttatcatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAATTGTGCTTCGGAAAGTCTCACCAATG ; Right flanking sequence: gtggggctcgacgtcaaggttttatttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaccgtcaacgctatcattaatttcatcc ; Right flanking sequence: gaaggcgaggcaagacgatttttctgtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2317 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaataaTTATACTGACGCGTATTTGCTG ; Right flanking sequence: CATtatggtctcatgaagtgctgctggaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.