IG1839 |
C. elegans |
frSi17 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi17 [mtl- 2p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi17 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in the intestine, making animals RNAi-deficient except for intestinal tissues. The frSi17 insertion can be detected using a primer within the mtl-2 promoter (jep1061: aacaaacgtgggatgtaacc) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 786 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc. (jep3108 is not present in the frSi17 transgene) Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454
|
|
IG1846 |
C. elegans |
frSi21 II; frIs7 IV; rde-1(ne300) V. Show Description
frSi21 [col-62p::rde-1 3'UTR] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. frSi21 inserted into ttTi5605 site using CRISPR/Cas9 engineering. RDE-1 activity is rescued in adult epidermal tissues, making animals RNAi-deficient except for hypodermal (skin) tissues from the young adult stage. The frSi21 insertion can be detected using a primer within the col-62 promoter (jep2245: caaaaaggcgggatgagcag) in combination with downstream primer in rde-1 (jep2817 tcatactcgtagtattcccg), producing a 965 bp product if insertion is present. rde-1(ne300) can be genotyped by sequencing the PCR product from jep2299: gaacaacgacaatcgagcacca and jep3108: ATcttgtgaccgaactgtcc (jep3108 is not present in the frSi21 transgene). Reference: Watts JS, et al. G3 (Bethesda) 2020 Nov 5;10(11):4167-4176. PMID: 32943454
|
|
SD1963 |
C. elegans |
unc-119(ed3) III; rde-1(ne300) V; gaEx234. Show Description
gaEx234 [elt-2p::elt-2::GFP + unc-119(+)]. Pick non-Unc to maintain. Long-lived. Overexpression of ELT-2. RNAi-resistant. Reference: Mann F, et al. PLoS.
|
|
SD1965 |
C. elegans |
unc-119(ed3) III; rde-1(ne300) V; gaEx233. Show Description
gaEx233 [unc-119(+)]. Pick non-Unc to maintain. Reference: Mann F, et al. PLoS.
|
|
SD1989 |
C. elegans |
rde-1(ne300) V; gaIs290. Show Description
gaIs290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. RNAi-resistant. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
|
|
WM118 |
C. elegans |
rde-1(ne300) V; neIs9 X. Show Description
neIs9 [myo-3::HA::RDE-1 + rol-6(su1006)]. Transgene rescues muscle RNAi defect. Rollers.
|
|
WM45 |
C. elegans |
rde-1(ne300) V. Show Description
RNAi deficient. Reference: Tabara H, et al. Cell 1999 Oct 15:99(2):123-32.
|
|