More Fields
Strain Species Genotype
ZT3 C. elegans csr-1(fj54) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+. csr-1 homozygotes are basically sterile, but some of them occasionally lay a small number of dead eggs. The fj54 mutation deletes a 524 bp region including half of the second exon, the third exon, and almost all of the fourth exon, causing a frame shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. Homozygous nT1[qIs51] inviable.
AV311 C. elegans dpy-18(e364) unc-3(e151) meT7 (III;X;IV). Show Description
Dpy. Unc. meT7 is an end-to-end-to-end fusion of chromosomes III, X, and V. The right end of III is fused to the left end of X, and the right end of X is fused to the left end of IV. Constructed by crossing eT5 and mnT12. meT7 homozygotes produce 92% viable progeny. meT7 heterozygotes are Him and produce many dead eggs.
CB3740 C. elegans eDf24 I; eDp20 (I;II); mnT12 (IV;X). Show Description
Phenotypically WT. See also CGC 801. eDf24 = let(e2000).
SP400 C. elegans mnT11 (X;II)/+ II; dpy-3(e27) X; mnDp11 (II;X;f). (mnT11 + mnDp11 = mnT2) Show Description
Hets are WT and segregate WT, Dpy and males of both kinds.
SP486 C. elegans mnT10 (V;X). Show Description
WT phenotype. Dominant him.
SP580 C. elegans mnT13 (I;X). Show Description
Dominant Him.
SP646 C. elegans mnT12 (IV;X). Show Description
Homozygous WT.