More Fields
Strain Species Genotype
SP2678 C. elegans unc-36(e251) III; mnIs64. Show Description
mnIs64 [myo-3p::unc-52(exons 15-19)::GFP + unc-36(+)]. Reference: Spike CA, et al. Development. 2002 Nov;129(21):4999-5008.
ST3031 C. elegans ncEx3031. Show Description
ncEx3031 [myo-3p::Arch::eGFP + rol-6(su1006)]. Pick GFP+ animals to maintain. Reference: Okazaki A, et al. PLoS One. 2012;7(5):e35370.
SV857 C. elegans heIs9 IV. Show Description
heIs9 [myo-3p::cyd-1 + myo-3p::cdk-4::Venus + myo-3p::GFP::H2B] IV. Expression of CYD-1, CDK-4::VENUS, and GFP::H2B in body wall muscles (BWM). Over-expression of tagged CYD-1 and tagged CDK-4 from integrated transgene causes incidental extra BWM nuclei. Expression levels are higher that those from heIs12 in SV860. Reference: Korzelius J, et al. PLoS Genet. 2011 Nov;7(11):e1002362. PMID: 22102824
SV860 C. elegans heIs12. Show Description
heIs12 [myo-3p::cyd-1 + myo-3p::cdk-4::Venus + myo-3p::GFP::H2B]. Expression of CYD-1, CDK-4::VENUS, and GFP::H2B in body wall muscles (BWM). Over-expression of tagged CYD-1 and tagged CDK-4 from integrated transgene causes incidental extra BWM nuclei. Expression levels are lower that those from heIs9 in SV857. Reference: Korzelius J, et al. PLoS Genet. 2011 Nov;7(11):e1002362. PMID: 22102824
TG4094 C. elegans unc-119(ed3) III; cxTi10816 IV; otIs433 V; gtEx4094. Show Description
otIs433 [dat-1::NLS::RFP + ttx-3::mCherry] V. gtEx4094 [glit-1p::GFP::glit-1 3'UTR + myo-3p::mCherry]. Pick animals with red fluorescence in body muscles to maintain. Transcriptional glit-1 reporter. Reference: Offenburger SL, et al.
TG4281 C. elegans unc-119(ed3) III; cxTi10816 IV; gtEx4170. Show Description
gtEx4170 [ttr-33p::GFP::ttr-33 3'UTR + myo-2p::mCherry + myo-3p::mCherry]. Pick mCherry+ animals to maintain. Transcriptional ttr-33 reporter. Reference: Offenburger SL, et al.
TU3403 C. elegans ccIs4251 I; sid-1(qt2) V; uIs71. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. uIs71 [(pCFJ90) myo-2p::mCherry + mec-18p::sid-1]. TRN-specific feeding RNAi. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
TY4986 C. elegans htp-3(y428) ccIs4251 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I,III). Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, htp-3(y428) ccIs4251 homozygotes that are GFP+ in body wall muscle but not pharynx, hT2 GFP+ homozygotes, and aneuploid dead embryos. Avoid picking viable aneuploids that often appear larger and longer than wild-type.
UTR133 C. elegans narSi2 II; mpk-1(ga117) III; narEx29. Show Description
narSi2 [mex-5p::GFP::mpk-1B + unc-119(+)] II. narEx29 [sur-5p::GFP::mpk-1A + myo-3p::RFP]. mpk-1(-) strain with germline MPK-1B rescued by single-copy insertion and somatic MPK-1A rescued by an extrachromosomal array. Pick RFP+ to maintain; narEx29 rescues mpk-1 so array should be stable. Transgene uses codon-optimized version of GFP. Reference: Robinson-Thiewes et al. Cell Reports, In Press.
VC4020 C. elegans R09B3.2(gk5093[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 621 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: ACCCGATATGAAGATCAACTTATTTGTTGG ; Right flanking sequence: TTTGGCCCCGCCCCTCGAATAGCATCGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4077 C. elegans lbp-8(gk5151[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 438 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: ATTAACAACTCAATTAATTCAGTCCTTCCT ; Right flanking sequence: CTGGGAGCGTCATTTGTCGTAGAGAGTTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4096 C. elegans eef-1A.2(gk5157[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1624 bp with Calarco/Colaiacovo selection cassette conferring myo-3 GFP and G418 resistance inserted at break. Left flanking sequence: CTCTCAGCCTAAAACATATTTAAGCCTCCC ; Right flanking sequence: GATCATCCGGAAAGGTCACCAAGTCCGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4262 C. elegans K07G5.5(gk5085[loxP + myo-3p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 2446 bp with Calarco/Colaiacovo selection cassette conferring myo-3::GFP and G418 resistance inserted at break. Left flanking sequence: GCGGTTGAAAATGTTCGATTGTTTCCAGCC. Right flanking sequence: GAGGGTATGGGACAAATCTCTTAATTGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VF14 C. elegans arIs37 I; unc-119(ed3) hmt-1(gk161) III; cdIs32. Show Description
arIs37 [myo-3p::ssGFP + dpy-20(+)] I. cdIs32 [unc-122p::DT-A(E148D)]. Hypersensitive to cadmium. Lacks coelomocytes and accumulates GFP in pseudocoelome. Maintain under normal conditions. Reference: Schwartz MS, et al., PLoS One. 2010 Mar 5;5(3):e9564.
VT3105 C. elegans maIs386 I; mir-34(gk437) X. Show Description
maIs386 [myo-3p::mir-34 + Cbr-unc-119(+)] I. DTC migration defects. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3109 C. elegans maIs390 II; mir-83(n4638) IV. Show Description
maIs390 [myo-3p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
WBM1126 C. elegans wbmIs61 I. Show Description
wbmIs61 [myo-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (I:2851000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs61 can be used to direct muscle-specific gene expression from the myo-3 promoter through CRISPR-mediated insertion of transcripts downstream of tissue-specific myo-3 promoter inserted as a single copy into the C. elegans genome. Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
WBM1133 C. elegans wbmIs63 I. Show Description
wbmIs63 [myo-3p::3XFLAG::wrmScarlet::unc-54 3'UTR *wbmIs61] (I:2851000). Superficially wild-type. SKI LODGE system allows for CRISPR knock-in of single-copy transcripts downstream of a tissue-specific promoter. wbmIs63 exhibits muscle-specific wrmScarlet expression driven the myo-3 promoter. Derived from parental strain WBM1126 by CRISPR-mediated insertion of wrmScarlet downstream of tissue-specific myo-3 promoter inserted as a single copy into the C. elegans genome (wbmIs61). Reference: Silva-García CG, et al. G3 (Bethesda). 2019 Jul 9;9(7):2195-2198.
WBM179 C. elegans wbmEx64. Show Description
wbmEx64 [rab-3p::nhr-49(cDNA)::unc-54 3'UTR + myo-3p::mCherry::unc54 3'UTR]. mCherry expression in muscle. Pick fluorescent animals to maintain. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
WBM409 C. elegans nhr-49(nr2041) I; wbmEx149. Show Description
wbmEx149 [ges-1p::3xHA::nhr-49(cDNA)::unc-54 3'UTR + myo-3p::mCherry::unc-54 3'UTR]. mCherry expression in muscle cells. Pick fluorescent animals to maintain. Intestine-specific rescue of nhr-49 null animals. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
XE1089 C. elegans sup-17(n316) I; oxIs12 X; wpEx22. Show Description
oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. wpEx22 [myo-3p::sup-17 + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain array. Muscular expression of SUP-17 from wpEx22 rescues sup-17(n316). Reference: El Bejjani R, Hammarlund M. Neuron. 2012; 73(2):268-78.
XE1220 C elegans wpEx76. Show Description
wpEx76 [myo-3p::tom20::tdKillerRed + unc-122p::GFP]. Pick GFP+ to maintain. KillerRed is a red fluorescent protein and photosensitizer that efficiently generates reactive oxygen species (ROS) when activated by light. wpEx76 carries a tandem dimer version of KillerRed targeted to the mitochondria by the addition of a tom-20 targeting sequence (mito-tdKillerRed). Reference: Williams DC, et al. Cell Rep. 2013 Oct 31;5(2):553-63.
XE1995 C. elegans wpIs98 I; ric-7(n2657) V; wpIs103. Show Description
wpIs98 [itr-1pB::Chrimson::SL2::mCherry + odr-1p::RFP] I. wpIs103 [myo-3p::GCaMP6 + myo-2p::mCherry].  ric-7 causes defective expulsion during defecation and slightly slow growth. Chrimson is expressed in DA9. GCaMP6 expressed in body wall muscles. Use 100 uM ATR in OP50 for optogenetic experiments. Reference: Ding C & Hammarlund M. Elife. 2018 Oct 29;7. pii: e38829. doi: 10.7554/eLife.38829.
ZM9028 C. elegans daf-2(m596) III; hpEx2905. Show Description
hpEx2905 [myo-2p::RFP + myo-3p::daf-2]. Pick RFP+ to maintain. Maintain at 15C. Temperature sensitive dauer constitutive. [NOTE: (07-14-2015) The genotype of this strain was incorrectly reported as daf-2(e1370), but is in fact daf-2(m596).] References: Hung W, et al. EMBO J. 2013 Jun 12;32(12):1745-60. Hung W, et al. Development. 2014 Apr;141(8):1767-79.
ZW129 C. elegans unc-68(r1162) V; zwIs108. Show Description
zwIs108 [myo-3p::Myc::ryr-1 + myo-3p::GFP]. GFP is expressed in body muscles. Locomotion is similar to unc-68(r1162).
ZW495 C. elegans zwIs132. Show Description
zwIs132 [myo-3p::GCamp2 + lin-15(+)]. Transgenic animals are GFP+ in body wall muscle. Maintain under normal conditions. Reference: Liu P, et al. J Physiol. 2011 Jan 1;589(Pt 1):101-17.
ZW64 C. elegans unc-68(r1162) V; zwIs100. Show Description
zwIs100 [rab-3p::Myc::ryr-1 + myo-3p::GFP]. GFP is expressed in body muscles. Larger and moves better than unc-68(r1162). Also called ZW64A.
ZX299 C. elegans lin-15B&lin-15A(n765) X; zxEx22. Show Description
zxEx22 [myo-3p::ChR2(H134R)::YFP + lin-15(+)].
ZX398 C. elegans lin-15B&lin-15A(n765) X; zxEx32. Show Description
zxEx32 [myo-3p::NpHR + myo-3p::ChR2(H134R)::YFP + lin-15(+)].