More Fields
Strain Species Genotype
FX30276 C. elegans egl-17(tmIs1234) X. Show Description
Break points: egl-17 X. Covered region (Mb) (0.5) Balancer marked with myo-2p::mCherry. Egl. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
GA800 C. elegans wuIs151. Show Description
wuIs151 [ctl-1(+) + ctl-2(+) + ctl-3(+) + myo-2p::GFP].  wuIs151 contains multiple copies of a PCR fragment containing the entire ctl-1 ctl-2 ctl-3 gene cluster.  Slow growing, especially at 25 degrees.  Raise at 20 degress or cooler.
GN600 C. elegans pgIs22 IV; oxIs95. Show Description
pgIs22 [unc-70::N-TSmod]. oxIs95 [pdi-2p::unc-70 + myo-2p::GFP]. The tension sensor module control (N-TSMod) was inserted at the N-terminus of unc-70. N-TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, but is placed at the N-terminus of UNC-70 where it is not sensitive to force. pgIs22 was a spontaneous insertion of pgEx157. Reference: Kelley M, et al. Elife. 2015 Mar 23;4.
GR1971 C. elegans mgEx779. Show Description
mgEx779 [lipl-4p::K04A8.5p::lipl-4::SL2::GFP + myo-2p::mCherry]. Polycistronic translational fusion; GFP and LIPL-4 expressed separately. Pick animals with red pharynx to maintain. Reference: Wang et al. Science. 2008 Nov 7;322(5903):957-60.
GR2250 C. elegans mgIs73 V. Show Description
mgIs73 [cyp-14A4p::gfp::cyp-14A4 3’UTR + myo-2p::mCherry] V. Reference: Mao K, et al. Cell Metab. 2019 Feb 14. pii: S1550-4131(19)30022-1.
GR3055 C. elegans suox-1(mg663)/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X Show Description
Larval lethal mutation balanced by tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)]. Balancer marked with myo-2p::Venus. Maintain by picking non-Unc GFP+ animals. Heterozygotes are wild-type GFP+ and segregate wild-type GFP+ heterozygotes, non-GFP mg663 homozygotes (lethal), and Unc GFP+ (homozygous tmC24). Reference: Warnhoff K & Ruvkun G. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0249-y.
GR3090 C elegans mgIs77 V. Show Description
mgIs77 [rpl-28p::ub(G76V)::GFP + unc-119(+) + myo-2p::mCherry] V. Reference: Lehrbach NJ, et al. Cell. 2019 Apr 18;177(3):737-750.e15.
GRU101 C.elegans gnaIs1. Show Description
gnaIs1 [myo-2p::yfp]. Control strain for pan-neuronal amyloid beta1-42 expressing strain GRU102. WT phenotype with pharyngeal YFP expression. Reference: Fong S, et al. Sci Rep. 2016 Sep 22;6:33781. doi: 10.1038/srep33781.
GRU102 C.elegans gnaIs2. Show Description
gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42]. Pan-neuronal amyloid beta1-42 expression. Impaired neuromuscular and sensorimotor behavior. See GRU101 for wild-type control strain. Reference: Fong S, et al. Sci Rep. 2016 Sep 22;6:33781. doi: 10.1038/srep33781.
GW1119 C. elegans lsm-8 (xe17[myo-2p::mCherry::unc-54 3'UTR]) IV/nT1 [qIs51] (IV;V); pkIs1582 V/nT1 [qIs51] (IV;V). Show Description
pkIs1582 [let-858::GFP + rol-6(su1006)] V. Homozygous lethal lsm-8 deletion balanced by GFP-marked nT1 translocation. xe17 generated by CRISPR/Cas9-engineered replacement of the gene with a red pharyngeal marker. lsm-8 heterozygotes are wild-type (will roll in this case because of plIs1582) green & red pharynx, and will segregate rolling heterozygotes (green & red pharynx), arrested nT1[qIs51] aneuploids (only green pharynx), and lsm-8 homozygotes (only red pharynx). Homozygous nT1[qIs51] inviable. Pick rollers with green & red pharynx and check for correct segregation of progeny to maintain. Reference: Mattout A, et al. Nat Cell Biol. 2020 May;22(5):579-590. PMID: 32251399
HA2823 C.elegans smn-1(rt248) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); nuIs175 X. Show Description
nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. smn-1 heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP rt248 homozygotes (larval arrest). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. NOTE: myo-2p::RFP is not visible in this strain. rt248 is a 8 bp deletion in smn-1. [rt248: TTTTGATTAGC--------ATCCCAAAC] [wild-type: TTTTGATTAGCTCCGTATCATCCCAAAC] Reference: Dimitriadi M, et al. Proc Natl Acad Sci U S A. 2016 Jul 26;113(30):E4377-86. O'Hern PJ, et al. Elife. 2017 May 2;6. pii: e20752.
HA2825 C.elegans smn-1(ok355) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); rtSi10 IV; nuIs175 X. Show Description
rtSi10 [smn-1p::smn-1 + Cbr-unc-119(+)] IV. nuIs175 [myo-2p::RFP + unc-129p::RFP::snb-1] X. rtSi10 transgene partially rescues smn-1(ok355): smn-1 homozygotes normally arrest as larvae, but somatic defects, including late larval lethality, are ameliorated by rtSi10. Sterility in smn-1(ok355) homozygotes is not rescued by rtSi10. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok355 homozygotes (sterile due to partial rescue by rtSi10). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: O'Hern PJ, et al. eLife 2017;6:e20752 doi: 10.7554/eLife.20752
HC114 C. elegans ccIs4251 I; qtIs3 III; mIs11 IV; sid-1(qt9) V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding and injection and endogenous hairpin expression.
HC271 C. elegans ccIs4251 I; qtIs3 sid-2(qt42) III; mIs11 IV. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. qtIs3 [myo-2p::GFP dsRNA hairpin]. mIs11 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP]. GFP expression in 4-cell embryos, pharyngeal muscle and gut. Resistant to systemic RNAi by feeding only.
HGA8001 C. elegans lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Pick animals with red pharynx to maintain. Lifespan is comparable to wild-type. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
HGA8002 C. elegans glp-1(e2141) III; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1 alone. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
HGA8004 C. elegans daf-16(mu86) I; glp-1(e2141) III; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of daf-16; glp-1 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
HGA8005 C. elegans glp-1(e2141) III; daf-12(rh61rh411) X; lynEx1. Show Description
lynEx1 [(pJG01)nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 20C or lower. Pick animals with red pharynx to maintain. Lifespan of animals carrying the array is longer than that of glp-1; daf-12 double mutants. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
HGA8012 C. elegans glp-1(e2141) III; daf-9(rh50) X; lynEx1. Show Description
lynEx1 [nhr-80p::nhr-80::GFP + myo-2p::DsRed]. Sterile at 25C. Maintain at 15-20C. Temperature-sensitve Daf-c. Mig. Pick DsRed+ animals to maintain. Reference: Goudeau J, et al. PLoS Biol. 2011 Mar;9(3):e1000599.
JIN810 C. elegans agIs26. Show Description
agIs26 [clec-60p::GFP + myo-2p::mCherry]. mCherry expression in pharynx. GFP expression in posterior gut is upregulated during S. aureus infection and at temperatures >15C. [NOTE: This strain has also been described as AU185 in publications.] Reference: Irazoqui JE, et al. Proc Natl Acad Sci U S A. 2008 Nov 11;105(45):17469-74. (PMID: 18981407)
JK2735 C. elegans qIs54 X. Show Description
qIs54 [pes-10p::GFP + myo-2p::GFP + F22B7.9::GFP]. Superficially wild-type. GFP expression in pharynx, gut and early embryos. qIs54 males mate, but not as well as wild-type. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JLF291 C. elegans wowEx68. Show Description
wowEx68 [ges-1p::3xHA::TurboID::unc-54 3'UTR + myo-2p::mCherry]. Pick mCherry+ to maintain. TurboID with HA tag is expressed in intestinal cells. Reference: Branon TC, et al. Nat Biotechnol. 2018 Oct;36(9):880-887.
JLF294 C. elegans wowEx71. Show Description
wowEx71 [ges-1p::3xHA::miniTurbo::unc-54 3'UTR + myo-2p::mCherry]. Pick mCherry+ to maintain. miniTurbo with HA tag is expressed in intestinal cells. Reference: Branon TC, et al. Nat Biotechnol. 2018 Oct;36(9):880-887.
JPS271 C. elegans vxEx265. Show Description
vxEx265 [gcy-8p::ICE + myo-2p:mCherry]. Pick mCherry+ animals to maintain. Expresses human caspase (ICE) to ablate AFD neurons. Reference: Vidal-Gadea AG, et al. Elife. 2015 Jun 17;4. doi: 10.7554/eLife.07493.
JPS278 C. elegans vxEx277. Show Description
vxEx277 [mec-3p::ICE + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx277 expresses a human cell death caspase (ICE) to ablate six touch neurons (ALML, ALMR, AVM, PLML, PLMR, and PVM), FLP, and PVD. Reference: Russell J, et al. Proc Natl Acad Sci U S A. 2014 Jun 3;111(22):8269-74.
JPS325 C. elegans slo-1(js379)V; vxEx325. Show Description
vxEx325 [slo-1p::hslo(T352I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx325 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx325 expresses human BK channel protein (hslo(T352I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS327 C. elegans slo-1(js379)V; vxEx327. Show Description
vxEx327 [slo-1p::slo-1(T381I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx327 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx327 expresses worm BK channel protein (slo-1(T381I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS338 C. elegans slo-1(js379)V; vxEx338. Show Description
vxEx338 [slo-1p::hslo(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx338 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx338 expresses human BK channel protein (hslo(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS344 C. elegans slo-1(js379)V; vxEx344. Show Description
vxEx344 [slo-1p::slo-1(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx344 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx344 expresses worm BK channel protein (slo-1(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS346 C. elegans slo-1(js379)V; vxEx346. Show Description
vxEx346 [slo-1p::hslo(D362/367A + 5D5N)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Partially resistant to ethanol and crooked neck phenotype. vxEx346 expresses human BK channel protein (hslo(D362/367A + 5D5N)) with compromised calcium-sensing residues and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS350 C. elegans slo-1(js379)V; vxEx350. Show Description
vxEx350 [slo-1p::slo-1(5D5N)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Partial crooked neck phenotype. vxEx350 expresses worm BK channel protein (slo-1(5D5N)) with purported calcium-sensing residues in the calcium bowl compromised and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS358 C. elegans slo-1(js379)V; vxEx358. Show Description
vxEx358 [slo-1p::slo-1(D391/396A + 5D5N)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Crooked neck phenotype. vxEx358 expresses worm BK channel protein (slo-1(D391/396A + 5D5N)) with purported calcium-sensing residues compromised and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS360 C. elegans slo-1(js379)V; vxEx360. Show Description
vxEx360 [slo-1p::slo-1(D391/396A)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Partially crooked neck phenotype. vxEx360 expresses worm BK channel protein (slo-1(D391/396A)) with purported calcium-sensing residues in the RCK1 domain compromised and a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS383 C. elegans slo-1(js379)V; vxEx383. Show Description
vxEx383 [myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Resistant to the effects of ethanol. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS48 C. elegans vxEx105. Show Description
vxEx105 [dat-1p::ChR2::mCherry + myo-2p::mCherry]. Raise on retinal for optogenetic manipulations (per Vidal-Gadea, 2011). Not necessary for survival. Reference: Vidal-Gadea A, et al. Proc Natl Acad Sci U S A. 2011 Oct 18;108(42):17504-9.
JPS481 C. elegans vxEx280. Show Description
vxEx280 [sto-5p::ICE + gcy-8::ICE + myo-2p::mCherry]. Genetic ablation of AFDL, AFDR, FLPL, FLPR, BDUL, and BDUR via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.
JPS482 C. elegans tax-4(p678) III; vxEx280. Show Description
vxEx280 [sto-5p::ICE + gcy-8::ICE + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Genetic ablation of AFD, FLP, and BDU via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.
JPS569 C. elegans che-6(e1126) IV; vxEx280. Show Description
vxEx280 [sto-5p::ICE + gcy-8::ICE + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Genetic ablation of AFD, FLP, and BDU via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.
JPS572 C. elegans slo-1(js379) V; vsIs48; vxEx345. Show Description
vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx345 [slo-1p::slo-1(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx345 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx345 expresses worm BK channel protein (slo-1(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS573 C. elegans slo-1(js379) V; vsIs48; vxEx348. Show Description
vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx328 [slo-1p::slo-1(T381I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx328 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx328 expresses worm BK channel protein (slo-1(T381I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS574 C. elegans slo-1(js379) V; vsIs48; vxEx339. Show Description
vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx339 [slo-1p::hslo(+)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx339 rescues ethanol-independent and ethanol intoxication phenotypes of a slo-1(null) mutants. vxEx339 expresses human BK channel protein (hslo(+)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS575 C. elegans slo-1(js379) V; vsIs48; vxEx326. Show Description
vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. vxEx326 [slo-1p::hslo(T352I)::mCherry::unc-54 3'UTR + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. vxEx326 rescues ethanol-independent phenotypes of a slo-1(null) mutants without rescuing ethanol intoxication. vxEx326 expresses human BK channel protein (hslo(T352I)) with a C-terminal mCherry tag. Reference: Davis SJ, Scott LL, Hu K & Pierce-Shimomura JT. J Neurosci. 2014 Jul 16;34(29):9562-73.
JPS582 C. elegans che-6(e1126) IV; vxEx582. Show Description
vxEx582 [gcy-8p::ICE + myo-2p::mCherry]. Pick animals with mCherry expression in the pharynx to maintain the array. Genetic ablation of AFD via expression of a human cell death caspase (ICE). Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.
JPS844 C. elegans vxIs824; vxIs591. Show Description
vxIs824 [rab-3p::ND18ApoE4::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Integrated transgene driving expression of human APOE4 throughout the nervous system; induces age-related neurodegeneration of HSNs and bag-of-worms in up to 60% of D3 adult worms. GFP expression in all serotonergic neurons. Reference: Sae-Lee et al. G3 (Bethesda) 2020 Aug 5;10(8):2851-2861. PMID: 32580938
JPS845 C. elegans vxIs823 II; vxIs824; vxIs591. Show Description
vxIs823 [rab-3p::APP::mCherry::unc-54 3'UTR] II. vxIs824 [rab-3p::ND18ApoE4::unc-54 3'UTR + myo-2p::mCherry::unc-54 3'UTR]. vxIs591 [tph-1p::GFP::unc-54 3'UTR]. Integrated transgenes driving expression of human APOE4 and human APP throughout the nervous system; induces age-related neurodegeneration of HSNs and bag-of-worms in >60% of D3 adult worms. GFP expression in all serotonergic neurons. Reference: Sae-Lee et al. G3 (Bethesda) 2020 Aug 5;10(8):2851-2861. PMID: 32580938
KG4247 C. elegans ceIs201 I. Show Description
ceIs201 [unc-17p::ins-22::Venus + unc-17p::RFP + unc-17p::ssmCherry + myo-2p::RFP]; integration site maps to I:0.77. Expresses INS-22::Venus to mark Dense Core Vesicles in the cholinergic nervous system, including the ventral cord cholinergic motor neurons. Also expresses mCherry in the same neurons to help identify the boundaries of the somas, axons, and dendrites. ssmCherry is mCherry with a secretion signal on its N-terminus, which is constitutively secreted and taken up by coelomoctyes in the pseuodcoelomic space, making it a useful marker for those coelomocytes. The INS-22::Venus also gets secreted by DCVs and taken up by coelomocytes. The myo-2::RFP is a co-tranformation marker that lights up the pharyngeal muscle cells and is useful for crossing the integrant into various mutant backgrounds. Reference: Hoover CM, et al. Genetics. 2014 Mar;196(3):745-65.
KN1510 C. elegans huIs120. Show Description
huIs120 [hsp-16.2p::sfrp-1 + myo-2p::Tomato]. Wild-type under normal culture conditions. Heat-shock (10 min) during embryogenesis causes embryonic lethality and HSN migration defects. Heat-shock (10 min) at hatching causes Ql and QR migration defects. Reference: Harterink M, et al. Development. 2011 Jul;138(14):2915-24.
KN689 C. elegans axl-1(tm1095) pry-1(mu38) I; muIs32 II; huEx83. Show Description
muIs32 [mec-7p::GFP + lin-15(+)] II. huEx83 [pry-1p::axl-1::GFP + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48.
KP3085 C. elegans nuIs122 IV. Show Description
nuIs122 [acr-2p::pHluorin::snb-1 + myo-2p::dsRed2] IV. Integrated transgene expressing synaptopHluorin under a cholinergic promoter for imaging motor neuron synapses.
KP3947 C. elegans nuIs183. Show Description
nuIs183 [unc-129p::nlp-21::Venus + myo-2p::GFP]. [NOTE: nuIs183 was previously described as carrying myo-2p::NLS::GFP.] Reference: Sieburth D, et al. Nat Neurosci. 2007 Jan;10(1):49-57.