More Fields
Strain Species Genotype
VH7047 C. elegans gst-15(hd7047[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2693 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGCTCTTTTTGAGAATTCGATTGAGAAGA; Right flanking sequence: GACATTTCGGCGGCAGTCAACATTAATGAA. sgRNA #1: ATAAAGTAGACATCTCGAGC; sgRNA #2: CTTGTCAATACTCTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7048 C. elegans gst-3(hd7048[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 724 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTAAAAGTTTATCGTTTTCAATATCCA; Right flanking sequence: TGGAGCAACTGGCCAGATGCACACTTATCT. sgRNA #1: GTTGATTAATGCCGAGTTGT; sgRNA #2: GCTCAGGAGACACAGACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7049 C. elegans efl-2(hd7049[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 4502 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGTGCTCGAGGGGCTCGGTTATGTGGAGA; Right flanking sequence: GGGCTTACCATTTTGTGGGCGTGGTTAGCT. sgRNA #1: GCTCGGTTATGTGGAGAAGG; sgRNA #2: CACAAAATGGTAAGCCCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7050 C. elegans sknr-1(hd7050[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2851 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGAGACCCGGCAAAGAAACAAAGATTATC; Right flanking sequence: GCATGGCATTTCATCAAGAACAAAGAGATA. sgRNA #1: AAGAAACAAAGATTATCGTG; sgRNA #2: TTGATCGTGACTACATGGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7051 C. elegans shw-1(hd7051[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 18084 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GCATTACAGGCTCAAGGGAAAGAACCTCGG; Right flanking sequence: TGGAGGTTTTTGCTCCGAGCATGATCCGAG. sgRNA #1: TGAGTGAATTGAGTTGTCCG; sgRNA #2: CGACGTGTACTCATCTTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7052 C. elegans ZK1058.3(hd7052[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1531 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAACAATCAATCTTAAATCCGCTTGCTCC; Right flanking sequence: CGCCGGAGATTGCTGCAAAAACGCTGAGCG. sgRNA #1: TTAAATCCGCTTGCTCCCGG; sgRNA #2: AAAACAACGGGATCTTTCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7053 C. elegans ZK697.8(hd7053[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 946 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCATTGGTAAATTTAGAATTTCAAGGTATC; Right flanking sequence: TACTGGCCTAAAAGATAAAAAGTCTTGTTT. sgRNA #1: TAGAATTTCAAGGTATCGGC; sgRNA #2: TGCATATGATTTCCTAGTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7054 C. elegans R09H10.3(hd7054[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 695 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTAAGAAAACTCCGCACACAAACCTCATTT; Right flanking sequence: CCCTGGAACCTACCGATTGGTCTACATCAC. sgRNA #1: GCACACAAACCTCATTTCGA; sgRNA #2: CCCGATTTCACCCTAATCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7055 C. elegans rfth-1(hd7055[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Show Description
Heterozygous strain. Homozygous early larval arrest without immediately obvious morphological defects. Deletion of 4370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGCGTCAGCTGCTCCTTCGTGTCGCCCCT; Right flanking sequence: CCTAAAACATCGTTATTGATCCTCCGCAAA. sgRNA #1: ATAGTATGGAGAGAGCCCTC; sgRNA #2: ATTAGTGAATGTGAGGTGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7056 C. elegans cest-13(hd7056[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 4312 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCAACATATGATGTGACAGTGCAAACACCA; Right flanking sequence: GCCTCAGTAGAGGTCCTCCGCCCCATCTTT. sgRNA #1: CGTATCGTTGCAGATCCATT; sgRNA #2: CATGTCACAACACGTAGGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7057 C. elegans tmem-39(hd7057[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1785 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGTCAATCCGACGACAATTGCAAGTTGAC; Right flanking sequence: CGGAAGGAGCTTGTGGTGGAGGTGCCGGCA. sgRNA #1: ATTCCCATACCTCGTTGATG; sgRNA #2: TCTTGGGATTGAAGCTGGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7058 C. elegans ctf-18(hd7008[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 3842 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCATTGTGTAATCTTTTCATTGCTCCG; Right flanking sequence: AAATGTTAGAAACACAATCTCACAACAATA. sgRNA #1: AAGAAGAAGAGACTATCTGC; sgRNA #2: CTAATGGATACAGCAAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7059 C. elegans prk-1(hd7059[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 11634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTCCTGGGGCACCGCCTACTTTTGCCGCCG; Right flanking sequence: CGAAAGAAATCGAGTATTTTCAAATCATTT. sgRNA #1: ATTGCTGACGGTGGGCGCGG; sgRNA #2: CATCCGAACTAAATTATAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7060 C. elegans asp-3(hd7060[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 2624 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGCATGATGAACTTGATGAGATAAACTG; Right flanking sequence: CGGAGGACAAAACTTCGATCTTCAAGGAAA. sgRNA #1: CTTGATGAGATAAACTGATG; sgRNA #2: AACATCACCTTCAACCTCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7061 C. elegans F10E9.4(hd7061[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ III. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 1418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAACGAGGATGGAACTACAGAAGTCCAGGA; Right flanking sequence: AGGATATTGATCTCAATAGCTCCAATTAAA. sgRNA #1: AACAGAAAGTGAAGCACCAA; sgRNA #2: ATTATGACTATGTACTTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7062 C. elegans drl-1(hd7062[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. Show Description
Heterozygous strain, might not be homozygous viable. Deletion of 1309 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTTTGAATTGAAAAGGGAGTGGTTTCCCT; Right flanking sequence: CGGCATTGAGTCTGGCGGCTGTTGCCGGTG. sgRNA #1: CCGATTCCGTTCCTAATCAC; sgRNA #2: GATTGGAATGGTGTTATGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7063 C. elegans kin-14(hd7063[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 2852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATGGAAGTTTCGCCCAGCATTGTTTCAAA; Right flanking sequence: TGGCAGTTACAGTTAAGTTACAATATTTGG. sgRNA #1: GCGATTTCAGAAATGGTTGG; sgRNA #2: CAACGAAATTTGGCGCTGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7064 C. elegans C08F8.6(hd7064[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTCTCGAAAGTCAATCAATACAACTCCT; Right flanking sequence: AGGTCTCCTTTCGGGTTGGAACACTTGTAG. sgRNA #1: CCTTCTTATCGTCTTCATAC; sgRNA #2: CCTCGACTTTAAGTGCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7065 C. elegans T23G7.2(hd7065[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1233 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCCAGTAATTCCAACACCCAAACTTCGCTC; Right flanking sequence: TGGGGCATAATACATAAAATAAATCGCTTG. sgRNA #1: ATTCCAATCATTTTCATGGG; sgRNA #2: AAACAAACCTGGAGAAATGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7066 C. elegans pph-1(hd7066[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2500 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTATTTTTTCGTTTTCAAAAAATAGTACCG; Right flanking sequence: CTGTCCCGGGTCCTTTCTTTTCTCCCGATT. sgRNA #1: CCTAGGTATTTTTGTTTTCT; sgRNA #2: CCCTTCAAACCATCACTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7067 C. elegans T25B9.2(hd7067[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1673 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTTTCGGCAGGAGTTTGTTTTTTTTTCCT; Right flanking sequence: TGGTAAAAAATGTTCTACAATTTTTTACAT. sgRNA #1: ACATTATTCACAGTACTCAC; sgRNA #2: GTTAGAAATCATTACATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7068 C. elegans Y51B9A.9(hd7068[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1571 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGCCCAAATTCGGTCAGTGTACTGAAAATC; Right flanking sequence: CAATAATGCTGAGGAAAAAAGCTTCGAATA. sgRNA #1: TCATCCTTCATTTGTCTGGG; sgRNA #2: GAATTTTCAGGCAACACTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7069 C. elegans gst-41(hd7012[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1003 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGCAACAGAGTGGAATGTTTGCTGATTCCA; Right flanking sequence: TGGCTTCAAGACAACTCACGACTAAAATAA. sgRNA #1: CGAGCCTTGCACAAACTAAT; sgRNA #2: AAAAACAACGGCTGTCTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7070 C. elegans hda-5(hd7070[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATATACCTATTTTCTCCTTGTTTTCCCC; Right flanking sequence: TGGAAAGATCCTCGCTATATTAGAAGGTGG. sgRNA #1: TGATGTTTGACCGATTATGG; sgRNA #2: CTCCTCAGCCAAATTTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7071 C. elegans hda-5(hd7071[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2776 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATATACCTATTTTCTCCTTGTTTTCCCC; Right flanking sequence: TGGAAAGATCCTCGCTATATTAGAAGGTGG. sgRNA #1: TGATGTTTGACCGATTATGG; sgRNA #2: CTCCTCAGCCAAATTTGCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7072 C. elegans C25A6.1(hd7072[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 988 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTGAAACATTTTTCAAGTCATGATTCCA; Right flanking sequence: TTTCCGGTAGAAATTTTCACCAACTTCCCG. sgRNA #1: AATTGCCCGGGAATTTCACC; sgRNA #2: GGTGTCGTTGTTTGTCAAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7074 C. elegans Y38H6C.8(hd7074[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1106 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAAGAGATGCTATGACAATCAAGAATAA; Right flanking sequence: ATTTAAGTTTTTTTTATTACAACAAAGTAC. sgRNA #1: ATTAATTCAAAGAAGGGTGG; sgRNA #2: CATCAAATCTCTAGGCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7075 C. elegans W04G5.10(hd7075[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGATTTCGAATCAAATCTTATTTTTTCTTC; Right flanking sequence: TCGTCAAAATGCGTCTCCAAATGTATAAAA. sgRNA #1: TTCTTCTTCGAAACACTCGG; sgRNA #2: ACTCGAGCAATTCAGACTTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7076 C. elegans M176.9(hd7076[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2297 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACTGCCAGAAGCCTATTTTTCGCTTTTCCC; Right flanking sequence: CTGATTACGACCTTTTAATAGCATAACTTG. sgRNA #1: GAAGATGGGACATTACAGAT; sgRNA #2: CTTTGTAGAAGGGATACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7077 C. elegans F45G2.9(hd7077[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATCGGCACAGCTCGATAAGCCTCAAGTGA; Right flanking sequence: GAGCTTTAACCGCAAATTCGTCTGTTGATT. sgRNA #1: TCCGTAGCGTTATCTCCAGT; sgRNA #2: GTGAGCACAATTACCGAGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7078 C. elegans W01F3.2(hd7078[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1872 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGAGAAGAAGAACTGCAACTACTACAGGA; Right flanking sequence: AGGGAAAGAGAATTTGGTGTCAGTAGGTGA. sgRNA #1: ATTCCAGTGATTTCTGTGGG; sgRNA #2: ACACAACGCATCAGTATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7079 C. elegans nhr-228(hd7079[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2424 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATTTTCAGAAGAACTGCTTCTGGGAAATGG; Right flanking sequence: GATATTGTTGGTACTCTCCACGAGCTGGAT. sgRNA #1: GATAACCAAAAGTGTCGTGG; sgRNA #2: CATTTCCTTGCAAGCCTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7080 C. elegans tcab-1(hd7080[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 4236 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATAGGAGACGTCCGGATTTGTCGATGGA; Right flanking sequence: CGGTTTTCTGGGATTTCTTCGGGAATTTCT. sgRNA #1: GAATCGTGTACGGTGTGTGG; sgRNA #2: TCTCTTTTCGATTTAATGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7081 C. elegans F26H9.5(hd7081[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1148 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GATTTTATCCATTTGAGAACGAGATTTGTT; Right flanking sequence: GAAAATTTGTCTTGAATTCTCACAATATCC. sgRNA #1: GTGTAGATACCTCCAGTTGG; sgRNA #2: AGAAATGTCGCATAGATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7085 C. elegans C25E10.4(hd7085[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 2304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTCCTAAACAGTGCCACTATCCCCATCCG; Right flanking sequence: TGGGCGTTTAATTTGAAAGAATTGAGTAAA. sgRNA #1: TTCTCAAAGGTCCCTTGTGG; sgRNA #2: TTCTTTCAATGGGTGCTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7088 C. elegans cest-32(hd7088[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1914 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTTTTCGAATTTTTGAATTTTGTCACCT; Right flanking sequence: AGGATCTCGAGCTTTTGTTTTTTTTTTCAA. sgRNA #1: GAAAAGAGACTTATACAGGC; sgRNA #2: ACATTTCTCAACTCGTCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7089 C. elegans C50F2.5.1(hd7089[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAAGCACGAATCTACAAACATTTTATTTT; Right flanking sequence: TGGCCCATAATTATGGGGCTCGAGTTGCTC. sgRNA #1: GCAATAGTTCTCAGTTCTCA; sgRNA #2: ACAGAGATTTTACTTCAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7090 C. elegans +/mT1 [umnIs52] II; vps-22(hd7082 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7082 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7082 and CGC66. hd7082 is a 525 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7092 C. elegans cyp-33C1(hd7092[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1987 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGGGAATTTGTTGTCTATTGCAAATCCA; Right flanking sequence: CGGACCAGTGGTTGCTCCGAGGTTGTTCAC. sgRNA #1: AAGGCTTTATATCCCGGTGG; sgRNA #2: CCGTCAATGGCCAAAGGCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7093 C. elegans acs-21(hd7093[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1797 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGTAAATTAGAAATATTCTAGTTTTAGG; Right flanking sequence: TGGAAGATGAGCAGAAGTTTGAAGAAGATT. sgRNA #1: TATTGTTCATCGATGATGGC; sgRNA #2: AGTTGTGCCGAAGAATATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7094 C. elegans ugt-25(hd7094[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3226 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAAATACGAAGACTACGGAAACTACATTAT; Right flanking sequence: AGGTCTTGGATCAACGAATGAATTGGCTTT. sgRNA #1: TTCAGAACTAATGGGCGGAG; sgRNA #2: ACTGCATTCATGACTCACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7095 C. elegans C30A5.4(hd7095[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 1745 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTTCTTGCGCTTAGCACCGCCCATTTTAAA; Right flanking sequence: AGACCCATGCAGAGAAACTGCTTGTGCCTT. sgRNA #1: ATCAATCAGCGAACTTTTGG; sgRNA #2: CTCCACGATCTCAGCTACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7097 C. elegans twk-47(hd7097[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 2010 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACACGGAAACCATACGTTGAAGCCTTTCCA; Right flanking sequence: TGGCAAAGCATCATCACTTATTCCAGAAAT. sgRNA #1: GAAGATGTTGCTTCACTTGG; sgRNA #2: CTTCTTTTAGTCCATCTTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7104 C. elegans F25B3.4(hd7104[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 4130 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTGCTGCTTCTACTGCCCCCGTGTCCCG; Right flanking sequence: TGGAATAAGACGTGTCAGCTCCATATCTGT. sgRNA #1: CCGTCCAAATCTCACGTCAC; sgRNA #2: AAAGTTTCTACATCCTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7106 C. elegans +/mT1 [umnIs52] II; mrps-23(hd7087 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7087 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7087 and CGC66. hd7087 is a 442 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7107 C. elegans +/mT1 [umnIs52] II; nars-2 (hd7098 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7098 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7098 and CGC66. hd7098 is a 5984 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7108 C. elegans E01A2.1(hd7099[loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7099 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7099 and CGC92. hd7099 is a 1508 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7110 C. elegans F54C9.9(hd7083 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7083 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7083 and CGC66. hd7083 is a 1871 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7111 C. elegans exos-8(hd7091 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7091 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7091 and CGC66. hd7091 is a 5126 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VH7115 C. elegans F46F11.10(hd7096 [loxP + myo-2p::GFP::unc-54UTR + rps-27p::neoR::unc-54UTR + loxP])/hT2 [umnIs73] I; +/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over mKate2 tagged hT2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7096 homozygotes), lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7096 and CGC92. hd7096 is a 667 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.