VC4344 |
C. elegans |
T24B8.4(gk5427[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 7128 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TAAAAAAGAAGACGAATAAGAACTAAATAG. Right flanking sequence: CCTTGGCCAATCGATCGAAGCTCCTGGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4349 |
C. elegans |
bud-31(gk5432[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1392 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACGGAACTTCCACCATTCTGTGAATTATA. Right flanking sequence: GTAGAACGGTGTCCAGCCATTATAGCAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4350 |
C. elegans |
F54F7.3(gk5433[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 858 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTCGCAAAGAAATACGTTTATGTAAGAGT; Right flanking sequence: GGGAAAAAAACAGTGAATAATATAGTTATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4353 |
C. elegans |
F10E9.2(gk5436[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1358 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GAAATTTGTTCAGTACTGGAATGAATTCCT; Right flanking sequence: AGGAGAAGAAAGAGAAGAAAAGTGCGGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4354 |
C. elegans |
T21B4.3(gk5437[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 854 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGACATAGGATTTCATCGATCACAAGACCG; Right flanking sequence: GGGAGTGTAGAAGTGAAGTCAATTGATCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4356 |
C. elegans |
M01G5.1(gk5439[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 10206 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATTCGATGCCAAATCATGTGGCAGCTCAA. Right flanking sequence: GGGGAATTCGAATTTCTTAATGGCTTGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4357 |
C. elegans |
ZK185.3(gk5440[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2074 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTTTTCTCCGTGTACCTCTTTGTACCAATG; Right flanking sequence: GGCGGCTGAATGCGATCTTTTCCAATTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4360 |
C. elegans |
Y48E1C.2(gk5443[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 4099 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTAAATTTTCAGATGGAAGAGCAGGAGCC; Right flanking sequence: GCCATCTACTCGACCCTCGAACCCGGCGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4361 |
C. elegans |
sucg-1(gk5444[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGATTTTTAAGATTAATAATGCTTCGTGCT. Right flanking sequence: GGAGGTGAACCAGCAAACTTCCTCGACGTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4364 |
C. elegans |
srr-7(gk5446[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2103 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTATGTATGAGCTCTTTTGGAATAGACAC. Right flanking sequence: CGCGGTTTTTTTTTCAAATTTGTATTTACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4366 |
C. elegans |
srg-1(gk5448[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1163 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AAATTTTTTGATTTTGAGTTGCCGAAGTAA; Right flanking sequence: CGGCATTCGGTATTCAGCTTCAATTTTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4369 |
C. elegans |
Y55F3BR.1(gk5450[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 8878 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATTGTATTTCAGTCCCGAATCCTGCAAAAA; Right flanking sequence: CACTATTTTCTTATCAAATTCCGTGTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4370 |
C. elegans |
oac-19(gk5451[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3916 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TACTCTCAAGTTGAGATGTGGTTGCCATTA; Right flanking sequence: CAGACAATGACCAGGTATGTGTGAAGATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4371 |
C. elegans |
Y41C4A.7(gk5452[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 751 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACATCACGAATTTGTCGCCGTTTCCGGTT; Right flanking sequence: TCAACGGGTAAGTCTTGTGTGCCTGCCTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4372 |
C. elegans |
W01A8.6(gk5453[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 2231 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCTACTGTCTGCTGATGTTCCGTTTGTA; Right flanking sequence: CTCACCAGGAATAGGAGAAATGAAAATAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4374 |
C. elegans |
F10B5.2(gk5455[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5005 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2246 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACTGCGATCTTGCTTCAAGCTATGCGAATG. Right flanking sequence: TCCGAGACTCTGCACACGCCGGTGATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4376 |
C. elegans |
stip-1(gk5457[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5006 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3229 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTGGTGCCATTGGTGGTGGTGGAGCCATTG; Right flanking sequence: TTTGGCTGCATGTTGTTTAGTGGCATGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4379 |
C. elegans |
Y43F8B.22(gk5460[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 697 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TATTATCAACGAAAAATCTTCACAGTTCCA; Right flanking sequence: AGAACTAAGATAAGTGCTATTCCATCAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4380 |
C. elegans |
rpl-10(gk5261[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mIn1[dpy-10(e128)] II. Show Description
Homozygous lethal or sterile deletion balanced by mIn1. Deletion of 772 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous mIn1 is non-GFP fertile Dpy-10. Left flanking sequence: TTCTCTTCTATATATATATATTCTCCGTTT; Right flanking sequence: TAATTTGGTATCCACTGTATTTGTTGAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4381 |
C. elegans |
cpsf-3(gk5271[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC9 IV. Show Description
Homozygous lethal or sterile deletion balanced by tmC9. Deletion of 4391 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC9 is non-GFP Mec-3 Unc-31. Left flanking sequence: GTGCCAATTTTCCAATTACTTTTGCCGTTT; Right flanking sequence: CATGGAAGTGCACCACAATGATCCAAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4382 |
C. elegans |
ptr-1(gk5276[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/tmC3[egl-9(tmIs1230)] V. Show Description
Homozygous lethal or sterile deletion balanced by tmC3. Deletion of 2147 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC3 carries myo-2p::mCherry and is Unc-23 Lon-3. Left flanking sequence: GAAAATAGGCAAAAATATTAAACCGTGAAG; Right flanking sequence: GGAAGTGTCATGTTATGATTGACTCCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4383 |
C. elegans |
cutl-13(gk5461[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 7739 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATAGAGAAGGATAATTTTTTAGGCCTCGG; Right flanking sequence: GAAGGATATTATCTAAGCAAACACTGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4385 |
C. elegans |
let-49(gk5463[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 890 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGTGCACAAACAGTCAGCCCGTTCCCAAAT. Right flanking sequence: GACGGAGTGCTTCATATGCTTCAGGAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4387 |
C. elegans |
col-35(gk5465[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1640 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTGCCATCTCAATATCTTTTTTTGCCACCG; Right flanking sequence: GAGTGATGTTTTCTTCCATTTCCACTTACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4389 |
C. elegans |
tftc-5(gk5467[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
[NOTE: Please see RG5031 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2935 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCTCGTATTATGGCGGAACGGAAACCTCAG; Right flanking sequence: GCAATGAATGAGCTAGTGGCTGTTGTAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4390 |
C. elegans |
glb-4(gk5468[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
[NOTE: Please see RG5007 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5263 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGGAACATACTTCTTCGTCGATATGGAGTA; Right flanking sequence: ATGTACTACATGTTTTCGATGTGTAGATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4391 |
C. elegans |
clec-266(gk5469[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1198 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGCAGATCGAGTAGAACTTGAAAGAGCATG. Right flanking sequence: AGCACTTCAAAAGTTTCGAGTGTTTTATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4393 |
C. elegans |
iars-2(gk5471[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5018 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3877 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAAATATTCGAACTTCTCGATGGTCCACCA; Right flanking sequence: ATAGAAAACAGGATTTGATGTTGAAAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4394 |
C. elegans |
pes-4(gk5472[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 7706 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGATAAAAAGGTGAGAAAATAGAGAAACGT; Right flanking sequence: TGGTGCAGGTGATGAATAATTTTCTCCCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4395 |
C. elegans |
B0432.10(gk5473[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1618 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGGTTTTTGTGGATCATATCGTACGGATT. Right flanking sequence: ATGAAATCCGTGATAAACTCGAAATTCGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4396 |
C. elegans |
lron-13(gk5474[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 9122 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAACACCGCCACGACAAATTTAACAGAAT. Right flanking sequence: CTTGGGAACAATCTCCAGCGCACAATTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4398 |
C. elegans |
C14B9.10(gk5476[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
[NOTE: Please see RG5032 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1853 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACCAAACCGTCAGACATGCTGCGTCTCCT; Right flanking sequence: AACTGGCAAGAAATGGTTCCGCATTGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4399 |
C. elegans |
Y48A5A.3(gk5477[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 562 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAATAATCAATAAAGTATCGATTTTTCCG; Right flanking sequence: TGAAAAAACATTAAAAATAGCGGTTATTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4400 |
C. elegans |
F28D9.4(gk5478[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5019 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2626 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTTTACCTATTGCTTTTGCTCTGTAGTA; Right flanking sequence: GACGGTGTTGCTGCTGGGCTGCTGCTCAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4402 |
C. elegans |
T04D3.8(gk5480[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 909 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GACGAAAAATCCAAATACATAACGAGACCC; Right flanking sequence: GGACTCAATTTCGACTATTTCCTGTTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4403 |
C. elegans |
hrpr-1(gk5481[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
[NOTE: Please see RG5020 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2871 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. [NOTE: VC4403 exhibits weak red fluorescence. The cause of this fluorescence is unknown, but gk5481 is a clean deletion/insertion confirmed by PCR.] Left flanking sequence: TTGCTTTCAGGCAATCGTCACGCTCGTTGA; Right flanking sequence: GGCGGGAGATCTGCAAAAATCGATAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4404 |
C. elegans |
F45G2.10(gk5482[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
[NOTE: Please see RG5033 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2468 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTAAACACGTTTTTATTCGAAACCTGAT. Right flanking sequence: GCTGGAAATGGAAAATGACGAAAAAATATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4406 |
C. elegans |
Y54F10AL.1(gk5484[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4078 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTCTAATCCCGCACCCACACGTAATGCAGA. Right flanking sequence: GGTGGTGGAGTTGCTTCTCAGTAAGGAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4408 |
C. elegans |
C13F10.7(gk5486[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1076 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGAGAAAATATTAATGTGGAGGTGGTTACT; Right flanking sequence: GATGGGTTTTATAGAAAAATTATCGATTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4411 |
C. elegans |
amt-2(gk5489[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4641 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATGAATATTAGGATTTTCTCCGTTCCAGTG. Right flanking sequence: GCATGCCAACCTGATTATCGACAAGTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4413 |
C. elegans |
R02F11.3(gk5491[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2082 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTCAAAAATTCCAGCAATTCAACCGTAC. Right flanking sequence: AGCCGGTGCTATTGTGGTTTCTATGTACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4414 |
C. elegans |
egl-17(gk5492[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 2375 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCGCTGTGAAAATCGTTTTACAGGCATCCA. Right flanking sequence: ATTTGTCCATCATGCAGTTCGTTCAAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4416 |
C. elegans |
cest-31(gk5494[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2081 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CCACTTCTGAATGTTTTAAACTCGACATGC; Right flanking sequence: AATCTCTCCTCTCGTGTTTTGAAAATTTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4419 |
C. elegans |
C16C8.20(gk5497[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1076 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTAGAGAGTTTTTTCTCGAATTTACCT; Right flanking sequence: CGGCAGTTTGCGAATAAATAATTGTGAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4420 |
C. elegans |
C15A11.2(gk5498[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1162 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GGTAGGCAGGCGAATTTTTATGTGCCTCCT; Right flanking sequence: CTGTTTTTGCATGCGAAATAGTTATTTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4423 |
C. elegans |
B0244.5(gk5501[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2573 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GAAGCGTATGAACTGCTGGTAGGGGTTTTA; Right flanking sequence: TGGCCATATTTTTCCTGCAGTGCCGCACGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4424 |
C. elegans |
T21G5.2(gk5502[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 1257 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCGAACAAAAGTCTCAAAAATGCTTTCACC; Right flanking sequence: ACCGTATCAAATACGACATCAACACCATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4426 |
C. elegans |
cal-2(gk5504[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1512 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGTTCGGTTGTTGGTGAAGCTGCTGAGCCA; Right flanking sequence: GATGAGAGCGAGTAAGCTCCGTTGGAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4432 |
C. elegans |
npp-11(gk5507[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 751 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CCAGATCAAATGTTTGGAGGATCTGCACCA; Right flanking sequence: CCATCAGCTTCTGCAGCTGCTTCTTCATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
VC4433 |
C. elegans |
ocam-1(gk5508[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 433 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCGATGCGTTTTCAGATTCATCATTGAC; Right flanking sequence: ATTTCTAGCTTGAAATGGAGGAAAGTACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|