EG5568 |
C. elegans |
dpy-13(ox495::Cbr-unc-119(+) + myo-2p::mCherry + unc-122p::GFP) IV. Show Description
dpy-13(ox495::Cbr-unc-119(+) + myo-2p::mCherry + unc-122p::GFP) IV. Dpy, mCherry pharyngeal muscle, dim GFP+ in coelomycytes. Insertion/deletion into cxTi10882 MosSCI site on Chr. IV. Can be used as balancer.
|
|
GW1119 |
C. elegans |
lsm-8 (xe17[myo-2p::mCherry::unc-54 3'UTR]) IV/nT1 [qIs51] (IV;V); pkIs1582 V/nT1 [qIs51] (IV;V). Show Description
pkIs1582 [let-858::GFP + rol-6(su1006)] V. Homozygous lethal lsm-8 deletion balanced by GFP-marked nT1 translocation. xe17 generated by CRISPR/Cas9-engineered replacement of the gene with a red pharyngeal marker. lsm-8 heterozygotes are wild-type (will roll in this case because of pkIs1582) green & red pharynx, and will segregate rolling heterozygotes (green & red pharynx), arrested nT1[qIs51] aneuploids (only green pharynx), and lsm-8 homozygotes (only red pharynx). Homozygous nT1[qIs51] inviable. Pick rollers with green & red pharynx and check for correct segregation of progeny to maintain. Reference: Mattout A, et al. Nat Cell Biol. 2020 May;22(5):579-590. PMID: 32251399
|
|
PD4790 |
C. elegans |
mIs12 II. Show Description
mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9::GFP] II. Hermaphrodites expressing compound GFP reporter (see PD4790). Strong pharyngeal muscle expression, easily scored by GFP dissecting scope. mIs12 is tightly linked to unc-4 II, and not to LG III or IV as previously reported. mIs12 homozygous males mate well (ME3). See WBG 15 #5 page 20. See CB5584.
|
|
PD4793 |
C. elegans |
mIs10 V. Show Description
mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Strong GFP signal. Suppresses recombination between unc-60 and dpy-11. See WBG 15 #5 page 20.
|
|
RG3000 |
C. elegans |
sra-34(ve500[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1822 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAATTAATACAAACAACAGGAGCTGGAACA ; Right flanking sequence: gaaggtattgaataaaacgcggaagttcta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3001 |
C. elegans |
sra-36(ve501[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: acggcatttactcacagaaaatgggaatat ; Right flanking sequence: cgcttcaaagtttgtaatttgaaatttgaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3002 |
C. elegans |
sra-1(ve502[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1018 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caaatacaaaaaactgtatttaagatgtaa ; Right flanking sequence: taccaacatgcatgtttcaagaaatctaga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3003 |
C. elegans |
sra-3(ve503[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1704 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: cagcgtgagaaaaatatcagaatgtgatcg ; Right flanking sequence: gtgggagattctatcaagagaattcactga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3004 |
C. elegans |
sra-4(ve504[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1294 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggtgtgaaagattttaaataaacaccctcg ; Right flanking sequence: CAAGGACATtctttaaaagtaaaaagaacc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3006 |
C. elegans |
sra-31(ve506[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1008 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gttttattttttaaatacCGTCATAAAAGC ; Right flanking sequence: CCAGGAATTTCCATtttagctgatatagat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3007 |
C. elegans |
sra-28(ve507[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 3237 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aggaaaattaaatttcaattttcttgttcc ; Right flanking sequence: ggaggtgttagcttttaaaatatgactggt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3008 |
C. elegans |
sra-29(ve508[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1279 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: agtattcactctttgttgtctttaccgaca ; Right flanking sequence: GCAAAAGGTTTTTGGTACAAAATGGAAATA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3009 |
C. elegans |
sra-20(ve509[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1413 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGTCGAAAGCTTAAGATGCGCTTCCGAAG ; Right flanking sequence: ctatcaatcctccttctttattttatcatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3010 |
C. elegans |
sra-18(ve510[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2034 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAATTGTGCTTCGGAAAGTCTCACCAATG ; Right flanking sequence: gtggggctcgacgtcaaggttttatttatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3011 |
C. elegans |
sra-17(ve511[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1733 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CGAGCTCCTCGAGAGCTTGAAATGCGCCTC ; Right flanking sequence: ATTGGAGTGATGACATCAATGTACGGAGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3012 |
C. elegans |
sra-27(ve512[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1310 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctcttagtattattattatttgttccccct ; Right flanking sequence: GGAGGAGTATATGGAAATCTATCAATTCCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3013 |
C. elegans |
sra-22(ve513[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1577 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaccgtcaacgctatcattaatttcatcc ; Right flanking sequence: gaaggcgaggcaagacgatttttctgtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3014 |
C. elegans |
sra-37(ve514[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2317 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaataaTTATACTGACGCGTATTTGCTG ; Right flanking sequence: CATtatggtctcatgaagtgctgctggaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3015 |
C. elegans |
sra-12(ve515[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1064 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTATTAGTGGAGCCAGAGAAACACAGGCA ; Right flanking sequence: CACGGGTACTTATTAATGGATAACACGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3016 |
C. elegans |
sra-26(ve516[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1961 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGTTTCATATGAGAATCCAGATCTCCATA ; Right flanking sequence: GTTCAGTAGTTTTATTCATtttgtgcttaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3017 |
C. elegans |
sra-9(ve517[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcagtttcaagatttcATGGCTACCATAG ; Right flanking sequence: ataggctgaaccaaaaaagtacatcgagtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3018 |
C. elegans |
sra-39(ve518[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2040 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC ; Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3019 |
C. elegans |
sra-32(ve519[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gtcaaatatgttccagtttttataccactc ; Right flanking sequence: ggtggttttgattattaatgggagcaaaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3020 |
C. elegans |
sra-24(ve520[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1150 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCGAAGGTCTCACCAATGCATTGACCTCGA ; Right flanking sequence: CTTGGCGTTAATTATTTGAGAATATTCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3021 |
C. elegans |
sra-33(ve521[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2545 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aaaaatcatcaaaatTCATTTATTCCACAT ; Right flanking sequence: gcacaaataatatgtgaaaaggggaacctt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3022 |
C. elegans |
sra-21(ve522[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1748 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tagagcagaaaccacacatctgctcacaga ; Right flanking sequence: tctggactgttattgaaagttttacgggtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3023 |
C. elegans |
sra-30(ve523[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 175 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ctgaaacagtaaattattaactaacCTGAA ; Right flanking sequence: TGAATTCATTGCCTCGAGAATTCCAGAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3024 |
C. elegans |
sra-38(ve524[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1918 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATAGCAATGATGAAAACATTAGTGGCATA ; Right flanking sequence: GGTGGTGATAGAGAAGTCCGTTTGACTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3025 |
C. elegans |
sra-25(ve525[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1944 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTGTGTTTGGTGAATTCCGTTTTCCACCA ; Right flanking sequence: atgacaatttctggatttttgggtacatct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3026 |
C. elegans |
sra-7(ve526[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1486 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tttcacagtccgttgacttttgatgcaatt ; Right flanking sequence: ACAGGATTCGTTCTTCACATGTTAGCCGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3027 |
C. elegans |
C40H5.2(ve527[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccaggcaatgatcaacgATGTACGCCTTAT ; Right flanking sequence: TCTGGAAGATCTTGAAGACTCTGCCATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3028 |
C. elegans |
C40H5.7(ve528[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 939 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTGTGAGCGAATTGTTAAATGGAGTGGCTT ; Right flanking sequence: atcacatgtcatatacagtattccattaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3029 |
C. elegans |
C34C6.3(ve529[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1562 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aatgattttcagttcagATGCCTTCCTCTG ; Right flanking sequence: TATGGAACACAACAAGATGGTAGATCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3030 |
C. elegans |
C46F4.3(ve530[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 794 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTTACTTTCCGTTTCTGCAAAACAAGTG ; Right flanking sequence: GGAGGAGTCTGCAGACCGTCGACAAAGTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3031 |
C. elegans |
F53C11.9(ve531[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 349 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattctcattgagaacatttcaacacacaa ; Right flanking sequence: CAAGGATTTGTTGTTGATTCAAATACCAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3032 |
C. elegans |
igeg-1(ve532[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2773 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATTTGGTCTTTCGATCCAATAACGTTGAA ; Right flanking sequence: AACGGAACATCAGATTCAAAACTGCTCGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3033 |
C. elegans |
igeg-2(ve533[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGTTAATAGTTGTCGTCGAGTACTTGGAGT ; Right flanking sequence: TGTGGTTCCCGTGTGTGTTCCTTcttaaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3034 |
C. elegans |
+/nT1[umnIs49] IV; C37C3.7(ve534[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste, Mig. Deletion of 1217 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste Mig GFP+ non-mKate2 (ve534 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GAAGTCGATGCCGTTCTGCAGTATCCTTCA ; Right flanking sequence: TACAATGACAAATCCCTCCAGCATAGATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3035 |
C. elegans |
nas-17(ve535[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 1433 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AATCACTTCGACATGTTTCTTCGACCATCT ; Right flanking sequence: TACGGAAGCAGCAAGTTGACAATTCATTAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3036 |
C. elegans |
irg-7(ve536[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 5265 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ccTTAGTTGTTGATACAGTAGACACCTCCA ; Right flanking sequence: GCTACAATTGTAACGTAGTCAACGCTAAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3037 |
C. elegans |
Y65B4BL.6(ve537[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 1682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ggctataaaacgacggaaaaagaaataaaa ; Right flanking sequence: ggcggtgaagccgtgtgtgtgtgtgtggct. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3038 |
C. elegans |
C26D10.3(ve538[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1301 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tctcgagtaattcgtatcctgcgaataaat ; Right flanking sequence: CAAGGAGAAGTGTGTGGAAGAGCGATGGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3041 |
C. elegans |
K06A9.3(ve541[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) X. Show Description
Homozygous viable. Deletion of 469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tgtcagaatcacaaaaaattatgttttttt ; Right flanking sequence: GGAGGGGCACATAGAATCAATCATGCGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3043 |
C. elegans |
T12A7.2(ve543[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 2862 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tttttgtaagtaaatttgaaatacccggta ; Right flanking sequence: tgaggaaaagaaatattgattaggcgtatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3045 |
C. elegans |
Y38C1AA.9(ve545[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 1665 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: gtaattgctcataaagatataaaaccccTT ; Right flanking sequence: CAATCACGTGCACTTTTTCGGCATGAATCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3049 |
C. elegans |
K07E1.1(ve549[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 979 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tattttctcctgctttcagttttgatttcc ; Right flanking sequence: ccatctgtcttgtaaatagagctctcttca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3050 |
C. elegans |
T01D1.4(ve550[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1770 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttgtctgatgtagaagtttagttgttgtgg ; Right flanking sequence: TGTGGGAGACGACGATCTCCGCATGGGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3051 |
C. elegans |
decr-1.3(ve551[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 1260 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCTTCCACGAATAACGTTCTCAACATCTCC ; Right flanking sequence: cgtggaacaccctttttaatctttaaactt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3052 |
C. elegans |
tdo-2(ve552[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) III. Show Description
Homozygous viable. Deletion of 2406 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: atttcaataatctCTAATCACTTTCTGATG ; Right flanking sequence: tgtgtaggcatcttatttcaaggaaacaaa. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
RG3053 |
C. elegans |
fbp-1(ve553[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 4852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCCTCGACGTCGAGTTTCGATCCGAGAATG ; Right flanking sequence: CCATttctgtaagaatttattgaattttga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|