Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAACGTGTATTTCGTCTGAAAAACTTGCCG ; Right flanking sequence: GGAGGAAAACTTCGATTCAGCATTCCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCATGAAGACATTGATGAGTAGACCAAGG ; Right flanking sequence: TCAAATGTCTTTTTACGAAACAAGACATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3301 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGAAGCACTCGGTGAAGTTTCGCAGGCTCA. Right flanking sequence: TCGTACTAATGTCCCTTCTAGTGTTGGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2870 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATGAGAGTGCATACGACCCAGAATACAAT. Right flanking sequence: CCTCGGTTCGCATATTCAGAATACCGAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5044 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2546 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTCGACGTTCGAATATGTACAAGAAAAGTC. Right flanking sequence: TGCTTCATCTGGTCATATGGTTTGGAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1500 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGCTTGTATCAGGTTTCACATGGGTTACCG ; Right flanking sequence: CAGGGAAGTCACAAACTTCTTTATGAATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 406 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAGAAACATGCCAATTCAAACCGATCTT ; Right flanking sequence: ACGGAGTCAAGTGCACTCGCGTCTACGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3626 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACGGGTACGACGAACAATGGGGCCATGC ; Right flanking sequence: TGACGGCAGGCAGACAGGCAGAACATGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGTTTTGGATGATTGGACGTAGTTGCACGA. Right flanking sequence: GCAGGATGAAAATAGGTTCCAATGACTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3837 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTCTTCATTATTCTACCCTTCTCACTAAC ; Right flanking sequence: GGTCTACCTTCAACACTACTACCCGGAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. [NOTE: The correct genotype of this strain is Y53F4B.12(gk5249). The strain was incorrectly identified as Y53F4B.13 when this strain was sent to the CGC.]

Homozygous viable. Deletion of 3445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTGAGAATTGGGAGACACCGGCTCCAGAC ; Right flanking sequence: TAAAATTAAACGTCGGATCCACAACACAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 855 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTCCAACTTACATCGTTCACTTCCTTCG ; Right flanking sequence: GATGGGTCGAGATTGTGGGAAAATATCATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 708 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGACTTTGTCAAACACGGAAAAACCATTA ; Right flanking sequence: GTTTGGTAGAGGAGAAAGAGTTCCATTAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGTACTACCACTCGGCGGTGAGGCCCGCCG ; Right flanking sequence: CTCTAATGGATCTCTGGTTGTGTGCCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 7975 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCCAGTCTGATTATCAATTGAAACCTTTG ; Right flanking sequence: CAAAGGTTTCAATTGATAATCAGACTGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2613 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGTTGAGGTGAAGCTCCAGAAGAACTCG ; Right flanking sequence: GGTGGTCTCGCTCGCGCAACGACATGGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2800 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAAAAAATACAAAAAAATCCTGAATTT ; Right flanking sequence: AGATACGGTAGACTACTGTAACCCGGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1796 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCGAAAACACGATATTTGATTTGAAAGCA ; Right flanking sequence: GATTCATCCGTTACAACTTCTATAGATTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCCATGGCAAAGCAAGGCAATCGGTTGAT ; Right flanking sequence: TGTGGACTTTTTTTCGAGAAAAAAAATAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGGAGAGTACGTTGAGACAATGTTTGACGC ; Right flanking sequence: GACTAAAGAAGAGCTGGCATACTAAGGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1616 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACTTCACAATTTGGGTTGACGCTCCCACTG. Right flanking sequence: CAGCCAAGTGTAGAAGTTACTCCAGTACAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4684 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGGTGATCATCGAAGATAGAATATTGGGGA; Right flanking sequence: TAGTGATATTGGTAGACGAGGTCCTTACCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 775 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAGTTTTATTTACGCCATAAAAACCTGCC ; Right flanking sequence: ATGGATGGGCGTTGAAGACGTCTGACAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2953 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGATTCGACGACAGATGACGAATGGACGG. Right flanking sequence: CACGGATTCAGGTCGAACACATTTTTAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1281 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTTTTTATTCACACGGTATATTGGGAGCAT. Right flanking sequence: TCTTTCAACACATAAACCTCTAGAAGGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCGTGTTTTACCATCAGATCAGTTGGCGTG ; Right flanking sequence: GATGGAATATGCTGCCTTCCAAGTTCATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4391 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCATGTCATCTGGCCTAGTTACAGCGTAGT ; Right flanking sequence: ATTGGATGTCTTCTCGCATTGTGGTAAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1685 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCATAATTGTTTGTTTGACAAAAACCGGGA ; Right flanking sequence: GGTGGAAACGGAAATGAAAGAAAAAACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2233 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CATCTTTAATTTTGGGAATACAAGCCCAAC; Right flanking sequence: TAGCAAAAGTATTCCGAACATTTTGGCGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2052 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTTAATCTGAAAAGCAACACTAGAAACCA; Right flanking sequence: GGGTTCAAATCAATTATTTCTGTAATTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2729 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGCAGAAGACTGTGGCTAAATGTTTCTAAT; Right flanking sequence: CGCTATAGGATTTCCACTTTTACAATGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1078 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAGTACGACAGAAAGCTGCTGATGTGC; Right flanking sequence: AAAGGGTTACTACACAATTGTTCAAACTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3733 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ACCTCTGCAATCCGGGCTCCAACATACATC; Right flanking sequence: GGTTCAGCTTGATAAGACTAGTCTGCGAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1078 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATCGAAAATGGGATATACTTTTGTCCAGCA; Right flanking sequence: GCTGGAAAAAATTTGGACCATTTTAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3394 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CCGGCCCTCGGAAGTGTTAGGAGCCTTGGT; Right flanking sequence: TTCTCTAGATATTTTCGGAGAACACCGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 537 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTAAATTCATAATTTTCAGATGTAAATCCA; Right flanking sequence: TTTTATGCATTCTCTCTCTTCCTTCTTCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1524 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATCTACGACTATTTCGATGGTGACCCACTG; Right flanking sequence: CTGGGCATCGAATAGCATTAACAGATTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1646 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTCAGGTACCAATTTTTTGGAACCCGAAA; Right flanking sequence: ACCATCAGCAACCATTCTGAAAATGAAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4104 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTTGAGCAAGAAAATGGGCGGAGCCCAGTA; Right flanking sequence: TTAGAGGATGATTATGATGGACAACGGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 9229 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CATTTTTATTTGAATTTTAGGCACTTAATT; Right flanking sequence: AGGATACTCTTCGATTCGCTGGTTTCTCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2067 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCGATTTTCAATTTTATTTTTGGACCGGAA; Right flanking sequence: AACGGAACAGTGACACACTTCGAGCTTGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 716 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTATTGTTTTTGTTGATTGTGACATCGGA; Right flanking sequence: CGCTCAGTAATAATCGATGAAGCGAGAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2262 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACAAATTCGCGCCGTCCACAGTACCTTTG. Right flanking sequence: CTCACAGATCAATCGGTTCGATTAAAATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1972 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTATTATTCTTCTTCAATCTAAATGCTGC; Right flanking sequence: AAGTCATTTTGCTATTTGTGATCTTCAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 812 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAATTAATACAACCGCAAAAGTTTGGG; Right flanking sequence: CGAGGAATAAAGATTTGAAAATTGATTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2072 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCTCCGATTGTATTTCTCAATATTTTAAG; Right flanking sequence: GGACAAGTGTCTCGGAGGGCATTTGAATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 7585 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCGATCAACCAATCTAAAGGCCTCCAGCA; Right flanking sequence: TTTCATGTCTATGCGTCTTGTCACTTATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 634 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTCCCATCAGAAGTGTAAGGCCTCAATATC. Right flanking sequence: TTTGGAGGCCTGTCGTCAGATGGGAGCTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1198 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GCTAGCAACAAACAATCATGTGCTCCTCCT; Right flanking sequence: GTGGGAAGGAGTAGATCAAAAAGTCAATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 20792 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTCATACTTTATGGAACTGTGTTCCCGCGC; Right flanking sequence: TAGAGCATCCCAATTGCCTCGATTCCATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.