More Fields
Strain Species Genotype
VC4144 C. elegans C50D2.2(gk5227[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1425 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAACGTGTATTTCGTCTGAAAAACTTGCCG ; Right flanking sequence: GGAGGAAAACTTCGATTCAGCATTCCATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4147 C. elegans F23F1.6(gk5230[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1753 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCATGAAGACATTGATGAGTAGACCAAGG ; Right flanking sequence: TCAAATGTCTTTTTACGAAACAAGACATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4148 C. elegans ptr-20(gk5231[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3301 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGAAGCACTCGGTGAAGTTTCGCAGGCTCA. Right flanking sequence: TCGTACTAATGTCCCTTCTAGTGTTGGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4151 C. elegans ptr-15(gk5234[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2870 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATGAGAGTGCATACGACCCAGAATACAAT. Right flanking sequence: CCTCGGTTCGCATATTCAGAATACCGAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4152 C. elegans gex-3(gk5235[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ IV. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2546 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTCGACGTTCGAATATGTACAAGAAAAGTC. Right flanking sequence: TGCTTCATCTGGTCATATGGTTTGGAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4155 C. elegans gbh-2(gk5238[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1500 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GGCTTGTATCAGGTTTCACATGGGTTACCG ; Right flanking sequence: CAGGGAAGTCACAAACTTCTTTATGAATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4159 C. elegans lbp-9(gk5245[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 406 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAGAGAAACATGCCAATTCAAACCGATCTT ; Right flanking sequence: ACGGAGTCAAGTGCACTCGCGTCTACGAGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4160 C. elegans ptr-13(gk5246[loxP + myo-2::GFPp::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 3626 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAACGGGTACGACGAACAATGGGGCCATGC ; Right flanking sequence: TGACGGCAGGCAGACAGGCAGAACATGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4162 C. elegans smg-4(gk5248[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1364 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGTTTTGGATGATTGGACGTAGTTGCACGA. Right flanking sequence: GCAGGATGAAAATAGGTTCCAATGACTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4163 C. elegans Y53F4B.13(gk5249[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 3837 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCTCTTCATTATTCTACCCTTCTCACTAAC ; Right flanking sequence: GGTCTACCTTCAACACTACTACCCGGAACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4164 C. elegans mab-20(gk5250[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ACTGAGAATTGGGAGACACCGGCTCCAGAC ; Right flanking sequence: TAAAATTAAACGTCGGATCCACAACACAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4167 C. elegans C56C10.9(gk5253[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 855 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTCCAACTTACATCGTTCACTTCCTTCG ; Right flanking sequence: GATGGGTCGAGATTGTGGGAAAATATCATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4168 C. elegans ZK1251.3(gk5254[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 708 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGACTTTGTCAAACACGGAAAAACCATTA ; Right flanking sequence: GTTTGGTAGAGGAGAAAGAGTTCCATTAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4171 C. elegans lgc-33(gk5257[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1847 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AGTACTACCACTCGGCGGTGAGGCCCGCCG ; Right flanking sequence: CTCTAATGGATCTCTGGTTGTGTGCCAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4174 C. elegans gkDf69[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] V. Show Description
Homozygous viable. Deletion of 7975 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCCAGTCTGATTATCAATTGAAACCTTTG ; Right flanking sequence: CAAAGGTTTCAATTGATAATCAGACTGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4183 C. elegans M03D4.4(gk5269[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2613 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGGTTGAGGTGAAGCTCCAGAAGAACTCG ; Right flanking sequence: GGTGGTCTCGCTCGCGCAACGACATGGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4187 C. elegans ubc-8(gk5273[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2800 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAAAAAATACAAAAAAATCCTGAATTT ; Right flanking sequence: AGATACGGTAGACTACTGTAACCCGGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4189 C. elegans K03H1.13(gk5275[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 1796 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTCGAAAACACGATATTTGATTTGAAAGCA ; Right flanking sequence: GATTCATCCGTTACAACTTCTATAGATTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4194 C. elegans W02B12.12(gk5279[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 2228 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATCCATGGCAAAGCAAGGCAATCGGTTGAT ; Right flanking sequence: TGTGGACTTTTTTTCGAGAAAAAAAATAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4195 C. elegans ist-1(gk5280[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 6442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGGAGAGTACGTTGAGACAATGTTTGACGC ; Right flanking sequence: GACTAAAGAAGAGCTGGCATACTAAGGTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4197 C. elegans syp-1(gk5282[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ V. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1616 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACTTCACAATTTGGGTTGACGCTCCCACTG. Right flanking sequence: CAGCCAAGTGTAGAAGTTACTCCAGTACAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4203 C. elegans ptr-19(gk5288[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 4684 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGGTGATCATCGAAGATAGAATATTGGGGA; Right flanking sequence: TAGTGATATTGGTAGACGAGGTCCTTACCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4204 C. elegans glb-15(gk5289[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 775 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TGAGTTTTATTTACGCCATAAAAACCTGCC ; Right flanking sequence: ATGGATGGGCGTTGAAGACGTCTGACAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4205 C. elegans Y71H2AM.20(gk5290[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ III. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2953 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGATTCGACGACAGATGACGAATGGACGG. Right flanking sequence: CACGGATTCAGGTCGAACACATTTTTAATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4206 C. elegans nbs-1(gk5291[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ II. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1281 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTTTTTATTCACACGGTATATTGGGAGCAT. Right flanking sequence: TCTTTCAACACATAAACCTCTAGAAGGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4207 C. elegans ugt-6(gk5292[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1469 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GCGTGTTTTACCATCAGATCAGTTGGCGTG ; Right flanking sequence: GATGGAATATGCTGCCTTCCAAGTTCATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4217 C. elegans oac-56(gk5303[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 4391 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCATGTCATCTGGCCTAGTTACAGCGTAGT ; Right flanking sequence: ATTGGATGTCTTCTCGCATTGTGGTAAAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4220 C. elegans frpr-16(gk5305[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1685 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TCATAATTGTTTGTTTGACAAAAACCGGGA ; Right flanking sequence: GGTGGAAACGGAAATGAAAGAAAAAACCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4222 C. elegans glc-1(gk5307[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 2233 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CATCTTTAATTTTGGGAATACAAGCCCAAC; Right flanking sequence: TAGCAAAAGTATTCCGAACATTTTGGCGTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4223 C. elegans Y57G11B.2(gk5309[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2052 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTTAATCTGAAAAGCAACACTAGAAACCA; Right flanking sequence: GGGTTCAAATCAATTATTTCTGTAATTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4226 C. elegans ptr-14(gk5312[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 2729 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGCAGAAGACTGTGGCTAAATGTTTCTAAT; Right flanking sequence: CGCTATAGGATTTCCACTTTTACAATGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4227 C. elegans K02E11.4(gk5314[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. Show Description
Homozygous viable. Deletion of 1078 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAGTACGACAGAAAGCTGCTGATGTGC; Right flanking sequence: AAAGGGTTACTACACAATTGTTCAAACTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4233 C. elegans lron-3(gk5319[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 3733 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ACCTCTGCAATCCGGGCTCCAACATACATC; Right flanking sequence: GGTTCAGCTTGATAAGACTAGTCTGCGAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4234 C. elegans K08E4.8(gk5320[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1078 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATCGAAAATGGGATATACTTTTGTCCAGCA; Right flanking sequence: GCTGGAAAAAATTTGGACCATTTTAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4235 C. elegans lron-11(gk5321[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 3394 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CCGGCCCTCGGAAGTGTTAGGAGCCTTGGT; Right flanking sequence: TTCTCTAGATATTTTCGGAGAACACCGTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4240 C. elegans F07H5.13(gk5324[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 537 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTAAATTCATAATTTTCAGATGTAAATCCA; Right flanking sequence: TTTTATGCATTCTCTCTCTTCCTTCTTCCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4243 C. elegans drd-1(gk5327[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1524 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATCTACGACTATTTCGATGGTGACCCACTG; Right flanking sequence: CTGGGCATCGAATAGCATTAACAGATTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4244 C. elegans E04F6.15(gk5328[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 1646 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTCAGGTACCAATTTTTTGGAACCCGAAA; Right flanking sequence: ACCATCAGCAACCATTCTGAAAATGAAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4247 C. elegans dhhc-11(gk5331[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I. Show Description
Homozygous viable. Deletion of 4104 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTTGAGCAAGAAAATGGGCGGAGCCCAGTA; Right flanking sequence: TTAGAGGATGATTATGATGGACAACGGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4248 C. elegans brc-1(gk5332[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 9229 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CATTTTTATTTGAATTTTAGGCACTTAATT; Right flanking sequence: AGGATACTCTTCGATTCGCTGGTTTCTCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4251 C. elegans C44B11.1(gk5335[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2067 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCGATTTTCAATTTTATTTTTGGACCGGAA; Right flanking sequence: AACGGAACAGTGACACACTTCGAGCTTGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4252 C. elegans F28C6.5(gk5336[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II. Show Description
Homozygous viable. Deletion of 716 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTATTGTTTTTGTTGATTGTGACATCGGA; Right flanking sequence: CGCTCAGTAATAATCGATGAAGCGAGAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4255 C. elegans F56C9.3(gk5339[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2262 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AACAAATTCGCGCCGTCCACAGTACCTTTG. Right flanking sequence: CTCACAGATCAATCGGTTCGATTAAAATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4256 C. elegans lron-14(gk5340[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 1972 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTATTATTCTTCTTCAATCTAAATGCTGC; Right flanking sequence: AAGTCATTTTGCTATTTGTGATCTTCAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4259 C. elegans Y51H4A.23(gk5343[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV. Show Description
Homozygous viable. Deletion of 812 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGGGAATTAATACAACCGCAAAAGTTTGGG; Right flanking sequence: CGAGGAATAAAGATTTGAAAATTGATTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4261 C. elegans lron-12(gk5345[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 2072 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCTCCGATTGTATTTCTCAATATTTTAAG; Right flanking sequence: GGACAAGTGTCTCGGAGGGCATTTGAATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4263 C. elegans pef-1(gk5346[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) III. Show Description
Homozygous viable. Deletion of 7585 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GTCGATCAACCAATCTAAAGGCCTCCAGCA; Right flanking sequence: TTTCATGTCTATGCGTCTTGTCACTTATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4265 C. elegans psf-2(gk5348[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/+ I. Show Description
Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 634 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTCCCATCAGAAGTGTAAGGCCTCAATATC. Right flanking sequence: TTTGGAGGCCTGTCGTCAGATGGGAGCTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4267 C. elegans M153.4(gk5350[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 1198 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GCTAGCAACAAACAATCATGTGCTCCTCCT; Right flanking sequence: GTGGGAAGGAGTAGATCAAAAAGTCAATCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
VC4269 C. elegans gkDf72[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP] II. Show Description
Homozygous viable. Deletion of 20792 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTCATACTTTATGGAACTGTGTTCCCGCGC; Right flanking sequence: TAGAGCATCCCAATTGCCTCGATTCCATAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.