PS9705 |
C. elegans |
asp-12(sy1899) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of asp-12. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAATCGCCAAAGATGCAAATGATGAGGCGAGGAGA. Right flanking sequence: ATGGGGAGCATACGTTCAACACAAGGCTGCCCTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGATGAGGCGAGGAGAATG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9707 |
C. elegans |
haf-6(sy1901) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of haf-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 2nd exon of the gene. Left flanking sequence: catatattttcccgttttttgcagCTTTTCCAGCT. Right flanking sequence: ATCCATGGCTTCACAAACCGATTTCAAGGACAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTGTGAAGCCATGGATAGC Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9711 |
C. elegans |
col-110(sy1737) IV. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of col-110. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CTGGTTTTGACGGTTGGAGCAATGGTAACCCTTCC right flanking sequence: ACTAGCCTATCATTATGTTAATCAGTTGAGAAATTC inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATAATGATAGGCTAGTGGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
|
|
PS9712 |
C. elegans |
ins-32(sy1905) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of ins-32 Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttgtctgaaaATGACCTCGATTCTGTTGATCCTTC. Right flanking sequence: TATTGGTTATCACCGTCACCGGGATGTTCCAGGAG Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GATTCTGTTGATCCTTCTAT Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9714 |
C. elegans |
haf-6(sy1907) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of haf-6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette) into the 1st one of the exons shared by all isoforms of the gene. Left flanking sequence: ctctgcactggattcccattcggagcacATGGTAC. Right flanking sequence: AAGAGGCGTTGAATAATGTGATGAAGGGCCGAACTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTCGGAGCACATGGTACAAG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9716 |
C. elegans |
tat-3(sy1914) III. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of tat-3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGTGGCAGAATCCTAAAAACGCATCCAGTAACA. Right flanking sequence: CGATGGCTGTTCCCAACTCAACCCATGCTTCCAC Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACGCATCCAGTAACACGA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9808 |
C. elegans |
mgrn-1(sy1915) X. Show Description
Superficially wild type but some including Pvl or Dpy phenotypes, poor locomotion, slow growth and sometimes ruptured. CRISPR/Cas9 engineered STOP-IN null mutant of mgrn-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGGAACACACACGAGCGGGGAAACTCGCACGATG. Right flanking sequence: ATGAGGACCCCGAAGCACAGATAACGTTCTCCAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGGAAACTCGCACGATGATG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9809 |
C. elegans |
C01G6.4(sy1916) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C01G6.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGGTTCGTCAGACAGCACGATGAGACGCCACTA. Right flanking sequence: CGACGgtaatttactttgtcattcactagtatactg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACGATGAGACGCCACTACGA Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9811 |
C. elegans |
C15C8.4(sy1918) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C15C8.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATCGGCGCACAACAAGAAAACACAGTATCGAACG. Right flanking sequence: GAACGGATCAACTTCATTTACGAAAAGGCATTGCAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAACACAGTATCGAACGGAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9813 |
C. elegans |
C03H5.4(sy1920) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C03H5.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCAATTTATGACACGTTGTATGACGCACCATGAT. Right flanking sequence: GCTTGGgtgagaaatttttaaagttctaaaatttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTATGACGCACCATGATGCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9815 |
C. elegans |
C07E3.9(sy1922) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C07E3.9. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTTTCAACGACTTGCTATTGCACCAATCCGAGAC. Right flanking sequence: TGAAGGCTCTCTGGAACCTGGAGGAGGTCGCTGAATG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGCACCAATCCGAGACTGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9817 |
C. elegans |
srh-30(sy1924) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of srh-30. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCACTTATATTACTATCCTAAATTTTATTCCGATA. Right flanking sequence: GTCACAGTTCCAATTTATGCGGAAGCAATTTACTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TAAATTGGAACTGTGACTAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9852 |
C. elegans |
C15H9.5(sy1935) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C15H9.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTATCTCCACAATAACAGGGAAATTTCACCATTT. Right flanking sequence: GGCATTGAGGgtttgtaaaaatattaaataaacaag. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TACAAACCCTCAATGCCAAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9854 |
C. elegans |
C16A11.2(sy1937) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C16A11.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTATCTCCACAATAACAGGGAAATTTCACCATTT. Right flanking sequence: CAATGGATGCGAAATGCACGTTGGCTGAATATGTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGCAATGTTTAATCTTTCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9855 |
C. elegans |
C18B12.4(sy1938) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C18B12.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGAAGAAGAATTAGTGCATAAATGTTTGGCGAA. Right flanking sequence: AGGTGGAAATTTTGGAATGGATGTTTCGGATTTTATC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CATAAATGTTTGGCGAAAGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9857 |
C. elegans |
C17F4.8(sy1940) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C17F4.8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTTTTTCAAACTTCCAAGTCTACTCTCACCATGAT. Right flanking sequence: CGACGGATTCTTTAAGATGATGCTCGAGAGTGAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCTACTCTCACCATGATCGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9858 |
C. elegans |
C18F10.7(sy1941) III. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C18F10.7. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTGGATTCGCCAGCGAAACTCGAATTCCCTCTA. Right flanking sequence: CACTGGGCAGTGTACGTCGACTGCAAGGATGAGCTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTCGAATTCCCTCTACAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9860 |
C. elegans |
C24A3.1(sy1943) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C24A3.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: cagACCGTCCGGGCAAGGACCTAAAGCACCAAAA. Right flanking sequence: GAAGGGCATGCGGTTACACCAAAGgtaaactatttatc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAACCGCATGCCCTTCTTT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9868 |
C. elegans |
C26B9.5(sy1945) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C26B9.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACTCCGAGTCAGCACGGCATCCCCACTTGCCACCG. Right flanking sequence: TATCTACTGGGGCGACCTACTGAACATGGATTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGTCGCCCCAGTAGATACGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9870 |
C. elegans |
F01D5.7(sy1947) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F01D5.7. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGCCTTCTATGCTACGTCGCATGCCCACCCATCC. Right flanking sequence: CATCGGAAATCATCCGGAAATTGGCATTCCACCCG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGCATGCCCACCCATCCCAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9872 |
C. elegans |
C31E10.5(sy1949) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C31E10.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCCCTCCAACTCCGCACGACAATTTGGTGGAGC. Right flanking sequence: GATTGGTGCTTGCAGGATGCAATTTGAATCGAGTAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGACAATTTGGTGGAGCGAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9874 |
C. elegans |
C31E10.6(sy1951) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C31E10.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGACCGTAAATTCTACAATAACTGGAAAGCCATTG. Right flanking sequence: AGCACTTTCCACGAGGTTATTCTGCATCAACTTTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACCTCGTGGAAAGTGCTCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9876 |
C. elegans |
F18A11.5(sy1953) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F18A11.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GGTAGTAATCTCAGCGAACGAGTTCTGCTGAATGT. Right flanking sequence: TGGCGGCAAAAAGTTCGAGACTACGGTCGCCACG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGAGTTCTGCTGAATGTTGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9880 |
C. elegans |
C33A11.2(sy1955) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C33A11.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTATCGCAGTGCTCAAACACGACGTCGATCCAATC. Right flanking sequence: TTCCCGTACCTCTCGTCGGCCGCCGACAAACGTCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GACGAGAGGTACGGGAAGAT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9882 |
C. elegans |
F09B12.5(sy1957) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F09B12.5. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: gaactaaaaattgcagATGAAACGTGTGCCGACG. Right flanking sequence: GTCAATTTCGATGTAGCAATGGAAGGTGTATAACG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCTACATCGAAATTGACCGT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9884 |
C. elegans |
srx-43(sy1959) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of srx-43. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAACCTTCGTGTACTCAAGTGATGACGCGCTGGCAG. Right flanking sequence: GGATGGTAGTTTCAATGgtaagtcaataaaatttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGATGACGCGCTGGCAGGGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9886 |
C. elegans |
srg-36(sy1961) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of srg-36. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAGTCTACGGAGCAGCACTACTAGTTCTGTACACCT. Right flanking sequence: ATGTGGTCATCATCATCATTGCACATAAAAAGTC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ACTAGTTCTGTACACCTATG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9888 |
C. elegans |
C28G1.6(sy1963) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C28G1.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCGGTTTGTGCATCAAAACTATTCGAAAACCCCGA. Right flanking sequence: AGTGAAATGTCCAACTTGTCGTCAGCCAATTGAGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGTTGGACATTTCACTTCG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9926 |
C. elegans |
F09G2.8(sy1979) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F09G2.8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GACACTCGAATAGAAGTTCCAACGAGTAAAAACAG. Right flanking sequence: CGGTGGTGACGGAATGCACAGTCCGTATTACGACG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CCAACGAGTAAAAACAGCGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9928 |
C. elegans |
F11E6.6(sy1981) IV. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F11E6.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATATTTTTTTGTTTCTCTTCTTAAGAAATATCCTCAT. Right flanking sequence: ATTCTACCGTTTCTTGCGTCCCGTGATGCATCAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCAAGAAACGGTAGAATATG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9930 |
C. elegans |
C44H4.4(sy1983) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of C44H4.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ctttttttcagATTCACAAAAAACTTGAAGCCCGAGC. Right flanking sequence: AGATATCCTTAGACGTGTTAAAAGGAAATAGTAAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CACGTCTAAGGATATCTGCT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9932 |
C. elegans |
trap-4(sy1985) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of trap-4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTCGCCAAAGTACTCGGCCTCGTCATTCTCCACTAC. Right flanking sequence: CGACGGATTCTTCCACTACAAAACCACCTTCATC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCGTCATTCTCCACTACCGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9934 |
C. elegans |
rab-39(sy1987) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of rab-39. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CTACCAATATCGTCTTATCGTTATTGGGGATTCAAC. Right flanking sequence: AGTTGGCAAATCTAGTCTTTTACGGTACTTCACAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTTATTGGGGATTCAACAGT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9935 |
C. elegans |
cyn-11(sy1988) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of cyn-11. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CGGATAACCCAATCGTTTTTCTAGAAGTTACCGC. Right flanking sequence: CGGTGGTGCACCAATCGGAACTATTGTTgtaagttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTTCTAGAAGTTACCGCCGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9957 |
C. elegans |
lim-8(sy1989) III. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of lim-8. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: ccacttttcagTCAAAAGAAGAAATCCTCCAAGT. Right flanking sequence: GAATTCGGCGTCTCGACCAGCACTGCCACGTCAGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTCGAGACGCCGAATTCACT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9959 |
C. elegans |
F16F9.1(sy1991) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F16F9.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACCATCATATAGCCCTCGCCGCCCTCCTCCACCA. Right flanking sequence: TACGAAGAGCAGAACAATCGAAATGCAAAAAAGgtg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TTGTTCTGCTCTTCGTATGG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9961 |
C. elegans |
imph-1(sy1993) III. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of imph-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAACTACAGGCCGTTCAACAGCAACAAGCCCAAC. Right flanking sequence: AGATGCACCATCGTCTTCAAGGAGCTCCGATCAATC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AAGACGATGGTGCATCTGTT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9963 |
C. elegans |
F26G1.1(sy1995) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F26G1.1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCCCGAAAATTCGAAACCGACCCGGATTTGGTAA. Right flanking sequence: TTCCGGCCGTTCAACACCCGTTAGAAGACGCAGAAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CGACCCGGATTTGGTAATTC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9965 |
C. elegans |
tep-1(sy1997) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of tep-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAGTACAAATGCAGCTGTGGTGTCAACAACCGCGG. Right flanking sequence: CGCCAGTTAAgtaagttctgtaaaatattgatgatc. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: AACTTACTTAACTGGCGCCG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9979 |
C. elegans |
dhp-1(sy2005) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of dhp-1. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CACCACTTGTTATCAAGAATGGAACTGTCGTCAATGA. Right flanking sequence: AGATGGAATGTTTAAAGCTGATGTTCTTGTTAG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAACTGTCGTCAATGAAGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9981 |
C. elegans |
Y105E8A.2(sy2007) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of Y105E8A.2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GATTCTATTCACTATTATGTGTCATTTACAAGTG. Right flanking sequence: ATTCGGTGACAATAAAAGATCCACCAACACTGGAAAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TGTGTCATTTACAAGTGATT. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9983 |
C. elegans |
itm-2(sy2009) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of itm-2. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GTGTGCGAGGCTGATGAGGAGAAGCACATCAGTAA. Right flanking sequence: CTGCGGCTGGGTACCAATGGAAGGAGGCAACTTTG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GAGAAGCACATCAGTAACTG. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9985 |
C. elegans |
sfxn-1.4(sy2011) II. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of sfxn-1.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GCTCCGCCGATTCTTGCTCGTCTCGTTCCATTT. Right flanking sequence: GCTGCTATTGCATTCGCCAATGCAATTAATATTCC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GCGAATGCAATAGCAGCAAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9987 |
C. elegans |
F21G4.6(sy2013) X. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F21G4.6. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATAACGGATGAATTAAGTACAAATGTATCGTTG. Right flanking sequence: GACAGGGAATTAAACCTTTTGAAATCGGCACAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTACAAATGTATCGTTGGAC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9993 |
C. elegans |
F22G12.4(sy2022) I. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F22G12.4. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: caccaaaacccaaccaatttccagAGAACCTTTCGG. Right flanking sequence: CAATGGATTTCCTGCTCGGCAACGGAGCCGATGG. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCCAGAGAACCTTTCGGCAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9995 |
C. elegans |
F33E11.3(sy2024) V. Show Description
Superficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of F33E11.3. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAAATGTTCGATATCAGCGATTGGCTCAGGAGTATA. Right flanking sequence: CGAAGgtgcggacgagaaaattttttttttttttg. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATTGGCTCAGGAGTATACGA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9997 |
C. elegans |
hint-1(sy1567) I; hint-3(sy2026) V. Show Description
Superficially wild type. Penetrance lethal with lots of unhatched eggs and slow growth. CRISPR/Cas9 engineered STOP-IN null mutant of hint-3 into hint-1(sy1567) stop-in mutant. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: catgttttacaggATGACGTCAATGCATACTTCTGT. Right flanking sequence: TAACGGATGCAAGTTTTGTGACATTGTCAAAAATA. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: TCAATGCATACTTCTGTTAA. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PS9999 |
C. elegans |
npp-10(sy2071) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile CRISPR null mutant balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP sy2071 homozygotes (L2 or early arrested sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. CRISPR/Cas9 engineered STOP-IN null mutant of npp-10. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CAATCAAAACAAAGGATTGTTTGGTCAGCCAGCC. Right flanking sequence: AATAACAGTGGAACTACTGGCCTTTTCGGGGCGGC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAGTTCCACTGTTATTGGC. Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.
|
|
PT8 |
C. elegans |
pkd-2(sy606) IV; him-5(e1490) V. Show Description
Males are response and location-of-vulva defective. pkd-2(sy606) is a 2396 bp deletion (8388 to 5942 in YAC Y73F8A); mutant protein is predicted to contain the N-terminal portion of the protein midway through the first predicted transmembrane region.
|
|
QA137 |
C. elegans |
tofu-6(yt2) II; ytEx100. Show Description
ytEx100 [mel-47(3245 bp rescuing fragment) + rol-6(su1006)]. Maintain by picking Rollers. Animals which have lost the transgene look wt but are fully penetrant Mel. Mutant embryos arrest with less than 100 cells.
|
|