or28 is a non-conditional maternal-effect embryonic lethal mutant ; the anterior pharynx is absent. and embryonic lethality is 100% penetrant. Pick single WT heterozygous hermaphrodites to maintain strain; these hets produce 11/16 dead embryos due to aneuploidy from translocation segregation and lethal homozygous hT2. The homozygous or28 hermaphrodites produce all dead embryos with defective pharyngeal development. or28 is a G to D mis-sense mutation at amino acid position 123. Strain produces lots of males due to him-8(ec56).

Recessive, temperature-sensitive embryonic lethal mutant . Maintain at 15C, most embryos will hatch. Nearly all embryos fail to hatch at 25C. Centrosomes are detached from nuclear spindle envelope in one-cell stage embryos; sometimes reattach to pronuclei; sometimes stay unattached throughout prophase until nuclear envelope breakdown. Mis-sense mutation in Q367P. Hook family member. Localizes to nuclear envelope and centrosomes; interacts with SUN domain proteins at nuclear envelope and interacts with dynein.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

mom-2(or85) is a recessive, non-conditional maternal-effect embryonic lethal. Strong allele; missense mutation near N-terminus: L77P. 85% of mutant embryos lack gut. Heterozygotes are Unc. [NOTE: (08-27-2014) We have been informed that the mutation carried in this strain is the same molecular lesion as or77. We are working to determine if or85 and or77 are in fact the same lesion or if an incorrect genotype was provided for the strain.]

mom-2(or33) is a recessive, non-conditional maternal-effect embryonic lethal. Intermediate strength allele; missense mutation near C-terminus: C321Y. 50% of mutant embryos lack gut. Heterozygotes are Unc.

Heterozygotes are WT and segregate WT and Uncs. The Uncs have a non-conditional maternal-effect embryonic lethal phenotype: the E blastomere adopts MS fate in about 5% of mutant embryos. The Uncs are 100% penetrant for embyronic lethality and morphogenesis defects.

or131 mutant embyros have a highly penetrant mom-like defect with mutant embryos lacking gut and making extra pharyngeal tissue at 25C. Maintain at 15C.

Temperature-sensitive, embryonic-lethal mutant that lacks a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). About 100% of embryos produced by homozygous mothers hatch at 15C; 0% hatch at 26C. ZEN-4 = vertebrate MKLP1 kinesin. There are two mis-sense mutations present in zen-4(or153). One is a D520N (GAC to AAC) and the other is D735N (GAT to AAT). Whether one or both is responsible for the phenotype is not know. Maintain at 15C. Shift L4s to 26 overnight to observe mutant phenotype on embyros produced by adults.

Homozygous mutant animals give rise to >99% dead embyros at the restrictive temperature of 26C, with embryos exhibiting a lack of pronuclear migration at the one-cell stage. Homozygous mutant animals give rise to viable progeny at the permissive temperature of 15C. Maintain at 15C.

Hypersensitive to copper and cadmium ions, and to starvation. [NOTE: Prior studies suggested possible cross-regulation of PMK-1 by MEK-1, but the identification of a tightly linked partial loss-of-function mutation in sek-1(qd127) in the strain carrying the mek-1(ks54) mutant allele (K. Reddy and D. Kim, unpublished data) suggests that the diminished PMK-1 activation observed in this mutant strain may actually be due to diminished SEK-1 activity.]

Dyf. Derived by crossing dye-filling mutant wu250 away from geIs3 (LG100 x N2 males). Reference: Burnett C, et al. Nature. 2011 Sep 21;477(7365):482-5.

arTi101 [lin-31p::ERK::KTR(S43A, T55A, S62A)::mClover::T2A::mCherry::his-11::unc-54 3'UTR + rps-27p::NeoR::unc-54 3'UTR]. Superficially wild-type. arTi101 transgene is a single-copy transposon insertion expressing a mutant, unphosphorylated form of a fluorescent protein (ERK::KTR::mClover) that reports MPK-1 kinase activity in vulval precursor cells (VPCs). A nuclear histone marker is co-expressed (mCherry::H2B). Use arTi101 as a negative control for transgene arTi85. Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.

arSi15 [mex-5p::ERK::KTR(S43A, T55A, S62A)::GFP(smu-1 introns)::T2A::mCherry::his-11::tbb-2 3'UTR]. arSi15 is a single-copy CRISPR/Cas9-engineered insertion expressing a mutant, unphosphorylated form of a fluorescent protein (ERK::KTR::GFP) that reports MPK-1 kinase activity in the germline. A nuclear histone marker is co-expressed (mCherry::H2B). Use arSi15 as a negative control for transgene arSi12. Reference: de la Cova C, et al. Developmental Cell. 2017 Vol. 42(5):542-553.

Superficially wild-type at 25C. Can be maintained 15-25C. rt448 is wild-type control strain for HA3299 containing all the silent codon changes needed for CRISPR/Cas9 genome editing. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682. NOTE: A micropublication on these strains (PMID: 33474528) incorrectly described sod-1(rt448) as the G85R mutant version and sod-1(rt449) as the control. Additionally, the strains list in the paper also incorrectly describes rt449 as sod-1 [G85RC]. The correct descriptions are that rt448 is the wild-type control, rt449 is the sod-1 [G93AC] mutant version, and rt451 is the sod-1 [G85RC] mutant version.]

sod-1(rt449[G93A C]) was created by CRISPR editing of the cognate glycine codon in C. elegans sod-1 to create a disease model for human mutation G93A. This strain also contains additional silent edits, and was back-crossed to remove the pha-1 allele used in strain construction. Under normal culture conditions HA2987 animals are superficially wild-type; after stress latent defects are observed. Reference: Baskoylu S, et al. bioRxiv 799932; doi: https://doi.org/10.1101/799932 [NOTE: A micropublication on these strains (PMID: 33474528) incorrectly described sod-1(rt448) as the G85R mutant version and sod-1(rt449) as the control. Additionally, the strains list in the paper also incorrectly describes rt449 as sod-1 [G85RC]. The correct descriptions are that rt448 is the wild-type control, rt449 is the sod-1 [G93AC] mutant version, and rt451 is the sod-1 [G85RC] mutant version.]

Superficially wild-type with increased sensitivity to paraquat in multiple assays. Can be maintained 15-25C. rt451 is CRISPR/Cas9 engineered G85R missense mutation in endogenous sod-1 locus mimicking human ALS SOD1 model. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682. NOTE: A micropublication on these strains (PMID: 33474528) incorrectly described sod-1(rt448) as the G85R mutant version and sod-1(rt449) as the control. Additionally, the strains list in the paper also incorrectly describes rt449 as sod-1 [G85RC]. The correct descriptions are that rt448 is the wild-type control, rt449 is the sod-1 [G93AC] mutant version, and rt451 is the sod-1 [G85RC] mutant version.]

syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791

This double mutant exhibits a doubling of both mean and maximum lifespans at 25C compared to N2. It exhibits a longer lifespan at 25C than it does at 20C. It has somewhat reduced fertility. It has normal development time, appearance, movements and feeding behavior. It's swimming rate in liquid is slightly higher than N2. STS mapping indicates the most likely location for age-2 is on LG I.

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-4(or344).

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-5(ye121).

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 24C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2.

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2..

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-3 and mat-2.

Temperature-sensitive embryonic lethal, maintain at 15C. Shift L4 hermaphrodites to 25C overnight for mutant embryos. Mutant embryos are sensitive to osmolarity and pressure. Previously called pod-6(ye143).

muIs16 [mab-5::GFP]. Larval lethal at L3/L4 stage. Ectopic expression of GFP in the arrested sor-1 mutant homozygotes (L3 stage). NOTE: This allele is published as bp1, but has been curated in WormBase as bp_1 in order to differentiate it from the STS marker bP1.

muIs16 [mab-5::GFP]. Larval lethal at L3/L4 stage. Ectopic expression of GFP in the arrested sor-1 mutant homozygotes (L3 stage).

nj53 is a SAX-7 long-form-specific deletion mutant. nj53 shos the normal neuronal position phenotype.

Improvement in thermotolerance at 37C, though weaker than in null mutants. Longer lifespan than to tax-2(gk117937) null mutant. Higher frequency of dauer formation and survival at 28C than tax-2(gk117937) null mutant. Reference: Hwang HY, et al. Front Genet. 2020 Oct 6;11:566948. doi: 10.3389/fgene.2020.566948. PMID: 33133151

Delayed hatching from egg shell. QL and descendant cells migrate forward instead of backward (incomplete penetrance). Tc1 insertion mutant.

Locomotion and feeding defects. Triple mutant lacks all muscarinic signalling. Reference: Steger KA & Avery L. Genetics. 2004 Jun;167(2):633-43.

Slow pumping. vu227 is the allele that is actually present in strains DA1316 and DA1370, not ad1051. For those working with DA1316 and DA1370 it may be useful to have an avr-15(vu227) single mutant for comparison. Reference: Dent et al., 2000, Proc. Nat. Acad. Sci. 97(6): 2674-2679.

mwEx32 [pat-3(YYFF) + sur-5::GFP]. Pick GFP+ to maintain. mwEx32 carries a mutant form of pat-3 gene with tyrosine (Y) to phenylalanine (F) mutations; rescues pat-3 null allele. Abnormal DTC migration. Reference: Lee M, et al. J Biol Chem. 2001 Sep 28;276(39):36404-10.

ax4544 is a CRISPR-engineered null mutant of npp-12. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."

Heterozygotes are WT and segregate WT, Dpys which give only dead eggs, mid-larval lethals (hT1 homozygotes), males and dead eggs. Mutation in pop-1 results in the MS blastomere adopting the fate of the E blastomere. pop-1 mutant embryos have twice the amount of wild type gut and only make anterior pharynx. him-5 is outside the region balanced by hT2.

Temperature-sensitive allele of cyd-1. Phenotypically wild-type at 15C. At 25C, approximately one-third of q626 hermaphrodites were missing one distal tip cell (DTC) and approximately one-half of q626 males were missing the linker cell (LC). q626 also feminizes the XO gonad. q626 affects the production of SGP daughters in both sexes. There is also a maternal component since the mutant phenotype is almost fully penetrant in offspring of homozygous mothers, but less penetrant in offspring of heterozygous mothers. Reference: Tilmann C & Kimble J. Dev Cell. 2005 Oct;9(4):489-99.

Medium Dpy. Robert Barstead deletion mutant in T28D6. Prolyl-4-hydroxylase alpha subunit. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

WT. Deletion mutant in F35G2.4. Prolyl 4 hydroxylase #2 deletion. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Maintain at 15C. Heterozygotes are WT, GFP+ in the pharynx and segregate WT (GFP+ in the pharynx), dead eggs (hT2 homozygotes) and non-GFP tra-1(q183) homozygous females. Raise strain at 15C; at 20C many heterozygotes are also feminized. tra-1(q183) is temperature-sensitive for its XX, but not its XO mutant phenotype. At 25C, both q183/q183 and q183/+ are female. At 15C, q183/q183 is still always female, but q183/+ can be hermaphroditic. Maintain by picking fertile GFP worms and checking for correct segregation, since the hT2 balancer is lost at low frequencies.

qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superficially wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. qSi370 can be prone to silencing, especially after severe starvation; silencing of GFP or mCherry expression can occur independently of one another. Maintain by picking animals with bright GFP and mCherry expression. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.

qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Superfically wild-type with expression of sfGFP and nuclear mCherry in germline. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.

qSi369 [sygl-1p::24xMS2 loops::3xflag::sygl-1::sygl1 3'UTR]. qSi370 [mex-5p:: MS2 Coat Protein::linker::sfGFP::tbb-2 3' UTR::gpd-2 intergenic sequence::H2B::mCherry::unc-54 3' UTR]. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ heterozygotes, non-GFP pharynx q224 homozygotes (Glp sterile at 20-25C) and dead eggs (hT2 homozygotes). All animals are sfGFP + in the germline, with distal and proximal transcription sites in the nucleus. qSi369 and qSi370 constitute an MS2 system which allows live visualization of sygl-1 nascent transcripts in the C. elegans germline in a glp-1 mutant background. Reference: Lee C, et al. Dev Cell. 2019 Aug 19;50(4):426-435.e4.

qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3'UTR::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem-loops in its 3'UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The GFP reporter RNA has three functional boxB stem-loops in its 3'UTR; the mCherry reporter 3'UTR has three mutated boxB stem-loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.

3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motif B disrupted (PIM B mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.

3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motifs A&B disrupted (PIM AB mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.

qSi380 [mex-5p::eGFP::3xOLASS::linker::his-58::MODC pest::3xboxb::tbb-2 3’utr::SL2 trans-splice site::mCherry::3xV5::linker::his-58::MODC pest::mutant 3xboxb::tbb-2 3'utr::tbb-1 intergenic region] IV. Worms are fertile at 20C. Improved tethering assay for use in the C. elegans germline. GFP reporter mRNA is under control of a germline-expressed mex-5 promoter and has three boxB stem–loops in its 3?UTR. The RNA-binding protein (RBP) is tagged with lamda-N. The nascent transcript driven by mex-5 promoter is resolved by trans-splicing into two mRNAs that encode distinct reporters. The gfp reporter RNA has three functional boxB stem–loops in its 3?UTR; the mCherry reporter 3?UTR has three mutated boxB stem–loops that do not bind lamda-N and therefore provides an internal control. Addition of an OLLAS tag to GFP and a V5 tag to mCherry enables sensitive immunostaining and immunoblotting. Reference: Doenier J, et al. RNA. 2021 Jun;(6)643-652. PMID: 33727224.

Homozygous maternal effect lethal double mutant balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested GFP+ nT1[qIs51] aneuploids, and non-GFP puf-3(q966) puf-11(q971) homozygotes (maternal effect lethal). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain.

3xV5 epitope tag inserted into C-teminus of endogenous lst-1 locus with PUF-interacting motif A disrupted (PIM A mutant). Reference: Haupt KA, et al. 2019 Oct 17;146(20):dev181644. PMID: 31515205.

qSi422 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site. GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

qSi424 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. Engineered TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter and GFP is visible in germline nuclei. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."

qSi425 [*rajSi50 (gld-1p::GFP::H2B::gld-1 3'UTR [FBEa TGT to ACA] [FBEb TGT to ACA] + Cbr-unc-119(+))] II. Maintain at 24C on OP50. Select well-fed adult animals with bright germline GFP in nuclei to propagate strain. qSi425 contains engineered TGT to ACA substitution in FBEa in rajSi50 gld-1 3’UTR reporter and substitution of downstream G to C to disrupt PAM site, and TGT to ACA substitution in FBEb in rajSi50 gld-1 3’UTR reporter. GFP is visible in germline nuclei. Derived by targeted modification of FBEb in parental strain JK6690. Kimble lab crossed original NIK50 strain with TX189 [oma-1::GFP] and back out again to reduce GFP silencing. Primers to confirm FBEa mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / prHJS401 TGGCAACATGATGTATCGCTGT (~100 bp band in FBEa mutant, no product in wild-type). Primers to confirm FBEb mutation: slc314 GTCACCAAGTACACTTCCAGCAAG / slc302 GGGTTAGCGTTAAGATAACTGT (~500 bp band in FBEb mutant, no product in wild-type). Reference: Carrick BH, et al. Dev Cell. 2024. "PUF partner interactions at a conserved interface shape the RNA-binding landscape and cell fate in Caenorhabditis elegans."