ABR212 |
C. elegans |
acd-1(sta6) delm-2(ok1822) I. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4).
|
|
ABR225 |
C. elegans |
acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.
|
|
AFS205 |
C. elegans |
zen-4(cle5) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle5), GAC to AAC (D520N), and one silent mutation, GCA to GCT at codon 519, that introduces an AluI site for RFLP analysis. A previous deposited version of this strain, zen-4(ok153), possessed two mis-sense mutations: GAC to AAC (D520N) and GAT to AAT (D735N). Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
|
|
AFS222 |
C. elegans |
zen-4(cle10) IV. Show Description
Temperature-sensitive embryonic-lethal mutant. Maintain at 15C. Shift L4s to 25C overnight to observe mutant phenotype of embryos produced by adults. Mutants lack a central spindle during early embryonic mitosis and exhibits a late cytokinesis defect (cleavage furrows regress after ingressing in nearly to the center of dividing embryonic cells). This strain can be used for CRISPR-Cas9 co-conversion. There is a causal mis-sense mutation present in zen-4(cle10), GAC to AAC (D520N), and two silent mutations. One silent mutation is a CGA to CGG mutation at codon 523 that creates a recognition site for a Cas9 guide RNA, in order to use zen-4(cle10ts) as a CRISPR/Cas9 co-conversion marker. The other silent mutation is a GCA to GCT mutation at codon 519 that introduces an AluI site for RFLP analysis. Reference: Farboud B, et al. Genetics Early online November 30, 2018; https://doi.org/10.1534/genetics.118.301775.
|
|
AV112 |
C. elegans |
mre-11(ok179) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Uncs (heterozygotes), non-Unc mre-11 homozygotes, and dead eggs (nT1 homozygotes). mre-11 homozygotes produce about 200 fertilized eggs but only about 2-3% of these eggs survive to adulthood (this mutation cannot be maintained in a homozygous condition). Occasionally non-Unc progeny that do not demonstrate the mre-11(ok179) mutant phenotype arise when grown in large liquid cultures. mre-11 is the predicted gene ZC302.1
|
|
AY1 |
C. elegans |
nol-6(ac1) II. Show Description
Temperature sensitive mutant. Grow at 15 to 20C. Sterile at 25C.
|
|
AY161 |
C. elegans |
mul-1(syb1027) IV. Show Description
F49F1.6. mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9-engineered ?1,650-bp deletion mutant of isoforms A and B (565 bp and 952 bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Derived by out-crossing parental strain PHX1027 (Suny Biotech) with N2 six times. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
|
|
AY162 |
C. elegans |
mul-1(syb1027) IV; acEx162. Show Description
acEx162 [mul-1p::mul-1::SL2::GFP + myo-2p::mCherry]. Pick mCherry+ to maintain. GFP expression in the intestine. acEx# transgene rescues mul-1(lf). mul-1(syb1027) [IV:4121342..4123166] is a CRISPR/Cas9 ?1,650-bp deletion mutant of isoforms A and B (565?bp and 952?bp deleted, with generated termination codon), leaving a predicted truncated protein of 46 amino acids. Reference: Hoffman CL, et al. mBio. 2020 Mar 3;11(2):e00060-20. PMID: 32127446
|
|
BJS737 |
C. elegans |
mpk-1(sbj10) III. Show Description
Temperature sensitive allele of mpk-1, bypasses UV sensitivity of csb-1 mutant at 20-25C. Reference: Bianco JN & Schumacher B. Nucleic Acids Res. 2018 May 21. doi: 10.1093/nar/gky404.
|
|
BP600 |
C. elegans |
aff-1(tm2214) II. Show Description
A 1.2 kb deletion in aff-1 (C44B7.3) which introduce stop codon after alanine 47. AFF-1 is a type I membrane protein necessary and sufficient for specific cell fusion events during embryonic and larval development. Temperature sensitivity was not detected. At 20° the fusion of hyp5 in the embryo does not occur as well as anchor cell (AC) fusion, vulval cells fusion of the A and D rings and the terminal fusion between the seam cells late in L4. 6% L1 rod-like lethal and 0% embryonic lethal. Adults are completely Egl, and partially Unc, Pvl. In addition, only 2% of AC in the mutant worms undergo fusion. These animals give very low brood size (16 progeny per worm) and 3.4% of the worms are sterile. This strain gives very small brood size and hence grows slowly. Originally from Shohei Mitani, Tokyo Women's Medical College, Tokyo, Japan.
|
|
BR5602 |
C. elegans |
tax-4(p678) III; byEx836. Show Description
byEx836 [odr-4p::tax-4::GFP + myo-2p::mCherry]. Pick mCherry+ animals to maintain. Rescues tax-4 null mutant. Expresses tax-4(+) in AWA, AWB, AWC, ADF, ASG, ASH, ASI, ASJ, ASK, ADL, PHA, and PHB sensory neurons, but not AFD sensory neurons. Reference: Liu S, Schulze E, Baumeister R. PLoS One. 2012;7(3):e32360.
|
|
BU7222 |
C. elegans |
pat-3(st564) III; kqEx73. Show Description
kqEx73 [pat-3(sp) + rab-3::RFP + cki-1::GFP]. Pick RFP+ to maintain. kqEx73 carries a form of pat-3 gene with splicing defects; rescues pat-3 null allele. pat-3(sp) is a frameshift mutation in the splice acceptor region (ag to aa) that abolishes conserved interaction domains such as the NPxY motifs and creates a splice variant with an extra 19 amino acids. The pat-3(sp) animals not only produce mutant pat-3, but also express the regular splice form due to utilization of an unusual splice acceptor. Abnormal Distal Tip Cell migration and pat-3 gene splicing (intron 7) defects. Reference: Kihira S, et al. PLoS One. 2012;7(8):e42425.
|
|
CB1600 |
C. elegans |
tra-2(f70) II. Show Description
Transforms XX to males. Variable expression. Masculinized self-fertile hermaphrodite. tra-2(f70) was crossed into the N2 background to construct a dpy-10 tra-2 unc-4 triple mutant, then crossed to remove the flanking dpy and unc (Jonathan Hodgkin).
|
|
CB3737 |
C. elegans |
sup-29(e1986) tra-3(e1903) IV. Show Description
WT phenotype. tra-3 amber mutant carrying homozygous linked amber suppressor.
|
|
CB4088 |
C. elegans |
him-5(e1490) V. Show Description
From CB1490, which is a double mutant of him-5 with ali-1. CB4088 has been outcrossed to remove ali-1.
|
|
CB4834 |
C. elegans |
tra-3(e1108); eEx24. Show Description
eEx24 [tra-3(+) + rol-6(su1006)]. Pick Rollers to maintain. Roller hermaphrodites producing more Rol hermaphrodites and non-Rol hermaphrodites that produce broods of 100% Tra-3 XX pseudomales. Tra-3 mutant rescued by transgenic tra-3(+); useful source of homozygous m+z- tra-3 XX hermaphrodites. Reference: Barnes & Hodgkin (1996) PMID: 8887539.
|
|
CB6144 |
C. elegans |
dpy-31(e2770) III; eEx512. Show Description
eEx512 [dpy-31(+) + sur-5p::GFP]. Pick GFP+ to maintain. Lethal dpy-31 mutant rescued by array containing dpy-31(+) 6.5 kb fragment. Reference: Novelli et al. (2004) PMID: 15579684.
|
|
CB6216 |
C. elegans |
bus-8(e2887) X; eEx541. Show Description
eEx541 [bus-8(+) + sur-5p::GFP]. Pick GFP+ to maintain. Nearly inviable, severely dumpy bus-8 mutant rescued by array. Reference: Partridge et al. (2008) PMID: 18395708.
|
|
CB6747 |
C. elegans |
glf-1(tm2412) IV; nbEx146. Show Description
nbEx146 [glf-1p::glf-1(+) + sur-5p::GFP]. Pick GFP+ animals to maintain. Array rescues glf-1(null) mutant. Reference: Novelli et al. (2009) PMID: 19751718.
|
|
CB7427 |
C. elegans |
unc-17(e245) IV; eEx849. Show Description
eEx849 [C28H8.4(sdmV186E)]. unc-17 missense mutant suppressed by missense C28H8.4 transgene. Pick non-Unc hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation).
|
|
CB7430 |
C. elegans |
unc-17(e245) IV; eEx855. Show Description
eEx855 [erd-2(sdmV186E) + sur-5p::GFP]. unc-17 missense mutant partly suppressed by missense erd-2 (a.k.a. sup-2) transgene. Pick GFP+ (weak Unc) hermaphrodites to maintain. Animals that have lost the array are severely Unc (coilers). Reference: Stroud et al (in preparation).
|
|
CB7476 |
C. elegans |
him-8(e1489) IV; galt-1(op497) V. Show Description
Him. Resistant to fungal toxin CGL2; weakly resistant to Leucobacter Verde1. Him strain derived from pmk-1;galt-1 double mutant. References: Butschi et al (2010). O'Rourke et al (in preparation).
|
|
CF1380 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
|
|
CF2060 |
C. elegans |
daf-16(mu86) I; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which rescues daf-16 mutants from defective dauer formation and also partially rescues longevity defect of daf-16; glp-1 double mutants. Reference: Berman JR, & Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.
|
|
CF2805 |
C. elegans |
dop-2(vs105) V; dop-4(ok1321) dop-1(vs100) dop-3(vs106) X Show Description
Quadruple mutant removing four different dopamine receptor genes.
|
|
CF978 |
C. elegans |
unc-24(e138) IV; bar-1(mu349) X. Show Description
Unc. QL descendants in a mutant position (anterior of ALM). Okay to grow at 15 or 20C.
|
|
CF980 |
C. elegans |
egl-20(n585) IV; bar-1(mu349) X. Show Description
Egl. QL descendants in a mutant position (anterior of ALM). Okay to grow at 15 or 20C.
|
|
CH1315 |
C. elegans |
zmp-1(cg115) III. Show Description
Superficially wild-type. 2366 bp deletion (965-3330 of U41266(EGAP1)) caused by imprecise excision of Tc1. Deletion can be detected by PCR with primers DSP4 (AATTAGTTGACGAGACAAGTCAGG) and B3 (AGTGAAGGCAGAATGTACTCC) --306 kb WT vs 1.2 kb mutant.
|
|
CP38 |
C. briggsae |
Cbr-tra-1(nm2)/Cbr-let(nm28) III. Show Description
When singled, hermaphrodites should throw 2/3 hermaphrodites and 1/2 nm2 XX males. The lethal appears to balance the nm2 allele pretty well, but precise recombination mapping has not been performed. The XX males maintain their phenotypic resemblance to the unbalanced strain and are probably not fertile due to obvious gonadal deficiencies. This strain has been successfully grown at 15C and 20C. Both strains appear to have complete penetrance of the mutant phenotypes.
|
|
CX5000 |
C. elegans |
slt-1(eh15) X. Show Description
slt-1 mutants have no dissecting-scope phenotype. They have a 40% penetrant defect in the ventral guidance of the AVM neuron scored with mec-4::GFP, a mild defect in CAN cell migration that is enhanced by a ceh-23::GFP transgene, and a mild defect in midline crossing by PVQ neurons scorable with sra-6::GFP. slt-1(eh15) is a complex rearrangement that duplicates the endogenous slt-1 gene, but disrupts both duplicated copies. The two copies are linked on X but the exact distance between them is not known. The duplication probably extends >13 kb based on Southern blotting. Deletion breakpoints for the first copy of slt-1 are as follows: nucleotides 26219 to 28163 and 28197 to 28294 in cosmid C26G2 are deleted. The second copy of slt-1 contains the following structure: nucleotides 28197 to 28294 in C26G2 are deleted, followed by a duplication of nucleotides 28300 to 28396 in C26G2 that begins 5 nucleotides after the deletion. Both copies of slt-1 are mutant, as confirmed by both DNA sequence and RT-PCR analysis of slt-1 mRNA. Scoring for homozygosity of the slt-1 allele by PCR is difficult because of the two copies of the gene and because the small deletion and the small duplication of the second copy of slt-1 are the same size. The mutant can be followed indirectly by X linkage (very closely linked to unc-3). It may be possible to make a specific primer within the duplicated region that detects a unique band in the slt-1 mutant.
|
|
CX5463 |
C. elegans |
slt-1(ok255) X. Show Description
Viable. Can be scored only using special neuronal markers such as zdIs5, which labels the touch cells and shows that they have aberrant anterior processes in the slt-1 mutant.
|
|
CZ1774 |
C. elegans |
vab-1(e856) ptp-3(op147)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.
|
|
CZ25708 |
C. elegans |
prg-1(ju1574) I. Show Description
Temperature sensitive sterility: maintain at 15-20C. prg-1(ju1574) mutant animals become sterile at the fifth generation grown at 25C. prg-1(ju1574) contains two mutations in the PIWI domain active site (RNaseH/slicer) [D583A, Y585A]. Mutation of the first conserved aspartate of the catalytic triad (D-D-H motif) to alanine (D583A) created an A-D-H motif which abolishes slicer activity in Argonaute proteins. WT:
[GTCGGCTACGATCTGTACCACGACTCGACATTGAAAGGAAAAACT --> VGYDLYHDSTLKGKT] ju1574: [GTCGGCTACGcgCTGgctCAtGAtTCGACATTGAAAGGAAAAACT --> CGYALAHDSTLKGKT] Forward genotyping primer:
GTAATGCTCGCTGACGACAA Reverse genotyping primer: TTGACGAACTGTGGAACCAA Reference: Kim KW, et al. Neuron. 2018 Feb 7;97(3):511-519.e6. doi: 10.1016/j.neuron.2018.01.014.
|
|
CZ5686 |
C. elegans |
vab-1(e2027) ptp-3(mu256)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.
|
|
DA1302 |
C. elegans |
avr-14(ad1305) I; avr-15(ad1051) V. Show Description
Moderate resistance to ivermectin. NOTE: originally described as carrying ad1302, but reported to actually be ad1305; see strain JD740 for verified avr-14(ad1302) I; avr-15(ad1051) V double mutant. Do not distribute this strain; other labs should request it from the CGC.
|
|
DA1880 |
Bacillus megaterium |
Bacillus megaterium. Show Description
Bacteria. Str-R. L10 papilla 2; sporulation-defective mutant. This is a low-quality food that is difficult for the worms to eat, and is useful for studies of the effect of food on behavior, physiology, etc. [NOTE: This strain grows better on NGM than on LB media in CGC.] Described in J Exp Biol 206: 2441-2457. Biosafety Level: BSL-1.
|
|
DA509 |
C. elegans |
unc-31(e928) IV. Show Description
Extensively backcrossed to N2. Background strain for most of the feeding-defective mutant screens.
|
|
DA522 |
C. elegans |
eat-13(ad522) X. Show Description
Eat mutant. Slippery pharynx. Slight relaxation defect.
|
|
DA596 |
C. elegans |
snt-1(ad596) II. Show Description
Eat mutant. Strong Unc Eat. Jerky backward Unc. Hypomorph.
|
|
DA602 |
C. elegans |
eat-15(ad602) I. Show Description
Eat mutant. Slippery isthmus, corpus and grinder.
|
|
DA707 |
C. elegans |
eat-17(ad707) X. Show Description
Eat mutant. Stuffs corpus and isthmus. Abnormality in m6 and m7 contraction timing. Displays clumping behavior; isolated in an RC301 background, so it's likely to have the RC301 bor-1 mutation.
|
|
DA726 |
C. elegans |
unc-10(e102) eat-13(ad522) X. Show Description
Unc. Eat mutant. Slippery pharynx-Slight relaxation defect.
|
|
DA837 |
Escherichia coli |
E. coli. Show Description
Bacteria. E. coli. Str-R. Uracil auxotroph. DA837 is derived from OP50. DA837 is harder for worms to eat than most E. coli strains. Some mild Eat mutant worms are easier to distinguish from WT when grown on DA837 than when grown on other E. coli strains. Biosafety Level: BSL-1.
|
|
DH261 |
C. elegans |
zyg-10(b261) III. Show Description
Temperature sensitive. Egg lethal. Abnormal first cleavage giving small P1 blastomere. Mutant is ts in late L4-early adult. Partial maternal (m,n).
|
|
DLM25 |
C. elegans |
hif-1(ia4) V; otIs197. Show Description
otIs197 [unc-14p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. otIs197 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
DLM26 |
C. elegans |
hif-1(ia4) V; otEx3165. Show Description
otEx3165 [unc-120p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from muscle-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. otEx3165 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
|
|
DLW14 |
C. elegans |
unc-5(lib1[myo-3p::GFP(-) + unc-119(+) + myo-2p::GFP(Mos1)]) IV; krIs14 V. Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008
|
|
DM7059 |
C. elegans |
pha-1(e2123) III; raEx59. Show Description
raEx59 [F22B5.10::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7062 |
C. elegans |
pha-1(e2123) III; raEx62. Show Description
raEx62 [B0412.3::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|
DM7065 |
C. elegans |
pha-1(e2123) III; raEx65. Show Description
raEx65 [C53B4.3::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
|
|