Mutator. Flanking sequence: gatttatccattttcaatcca cattttggatggtaaattctca.Mutator.

Mutator strain. Throws males. See WBG 14(2): 24. Strain has a ts phenotype: dies out at 25C, grows at 20C, but best kept at 18-20C. Not known whether it is the mut-7 allele that is ts or something else.

Dominant RNAi deficient. Temperature-sensitive sterile. E439K mutation in conserved Mg2+ coordinating residue. Reference: Gu W, et al. Mol Cell. 2009 Oct 23;36(2):231-44.

sEx14993 contains [rCes ZK1098.8::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

ccEx7271 [let-858::GFP + pha-1(+)]. This strain expresses nuclear-localized GFP in all somatic nuclei, but reduced or no GFP in germ cells. If maintained at 20C, pha-1(ts) genotype will select for transgenic animals. Germ cell expression can be observed when maintained at 25C. Germline transgene silencing is abnormal.