CB1396 |
C. elegans |
mut-1(e1396). Show Description
Mutator.
|
|
DR7 |
C. elegans |
unc-33(m7) IV; mut-1(e1396). Show Description
Unc.
|
|
GR1747 |
C. elegans |
mut-15(tm1358) V. Show Description
Him. Mutator. RNAi-defective. Temperature-sensitive sterile at 25C. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.
|
|
GR1748 |
C. elegans |
unc-119(ed3) III; mgSi2 IV. Show Description
mgSi2 [mut-16p::mut-16::GFP::mut-16 3'UTR + unc-119(+)] IV. MosSCI integrant of mut-16::GFP rescues pk710. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.
|
|
GR1823 |
C. elegans |
mut-16(mg461) I. Show Description
RNAi-deficient in soma. Reference: Zhang C, et al. Proc Natl Acad Sci U S A. 2011 Jan 25;108(4):1201-8.
|
|
JH3571 |
C. elegans |
mut-16(ax4313[mut-16::meGFP]) I. Show Description
meGFP tag inserted at C-terminus of endogenous mut-16 locus. Reference: Thomas, Bodas, and Seydoux (2025). "FG repeats drive co-clustering of nuclear pores and P granules in the C. elegans germline."
|
|
JK3826 |
C. elegans |
mut-16(mg461) I; larp-1(q783) III. Show Description
Slow growing and throw about 10% dead embryos. q783 is a deletion of the first 4 exons on the larp-1 gene. NOTE: this strain is carrying mut-16(mg461) in the background; It is unknown if mg461 is homozygous in this strain. See JK4545 for a replacement larp-1(q783) strain. mut-16 can be detected using primer1 CCCGCCGATACAGAAACTAA, primer 2 AATATTCGATCGGCAAGCAG for genotyping. The wild-type locus will yield a 824bp PCR product, whereas mg461 will yield a 373bp product. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
JK4545 |
C. elegans |
larp-1(q783) III. Show Description
Derived by outcrossing JK3826 to remove mut-16 deletion. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
NL1800 |
C. elegans |
mut-16(pk700) I. Show Description
|
|
NL1810 |
C. elegans |
mut-16(pk710) I. Show Description
|
|
NL1838 |
C. elegans |
mut-14(pk738) Show Description
Mutator strain. TS. RNAi defect. TATTCTGGAC A AAGCTGATAA.
|
|
SHG2030 |
C. elegans |
mut-16(ust366[mCherry::mut-16]) I. Show Description
mCherry inserted into endogenous mut-16 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.
|
|
YY1492 |
C. elegans |
mut-16(cmp3[mut-16::gfp::flag + loxP] I; znfx-1(gg634[HA::tagRFP::znfx-1]) II; pgl-1(gg640[pgl-1::3xflag::mCardinal]) IV. Show Description
gfp::flag inserted into endogenous mut-16 locus, 3xflag::gfp inserted into endogenous znfx-1 locus, and 3xflag::tagRFP inserted into endogenous pgl-1 locus using CRISPR/Cas9 engineering. Reference: Wan G, et al. Nature. 2018 May;557(7707):679-683.
|
|
YY470 |
C. elegans |
dcr-1(mg375) III. Show Description
Enhanced RNAi response. Sterile at 25 C. Outcrossed from YY11; wild-type for mut-16. Superficially wild-type.
|
|