More Fields
Strain Species Genotype
DA1880 Bacillus megaterium Bacillus megaterium. Show Description
Bacteria. Str-R. L10 papilla 2; sporulation-defective mutant. This is a low-quality food that is difficult for the worms to eat, and is useful for studies of the effect of food on behavior, physiology, etc. [NOTE: This strain grows better on NGM than on LB media in CGC.] Described in J Exp Biol 206: 2441-2457. Biosafety Level: BSL-1.
DA2100 C. elegans ser-7(tm1325) X. Show Description
Lack of 5HT stimulation of pumping. Primers GGCCTGCCTTCCTGACATGT, CGCGGATTCTCTATCAATAG, ATCCTG GAGCTGGCGAGTTA, GACTGTAAACGCGCAGAGTC. Mutation site 42634-42635 - GGGAANNAAAACCCTCCCTNNANNANNATNNGCANNCC - 43376-43377. 742 bp deletion + 38 bp insertion.
DA467 C. elegans eat-6(ad467) V. Show Description
Abnormal feeding. Strong relaxation defective. NOTE: This strain is reportedly homozygous for an unknown X-linked unc mutation (10/31/2017).
DA509 C. elegans unc-31(e928) IV. Show Description
Extensively backcrossed to N2. Background strain for most of the feeding-defective mutant screens.
DA522 C. elegans eat-13(ad522) X. Show Description
Eat mutant. Slippery pharynx. Slight relaxation defect.
DA596 C. elegans snt-1(ad596) II. Show Description
Eat mutant. Strong Unc Eat. Jerky backward Unc. Hypomorph.
DA602 C. elegans eat-15(ad602) I. Show Description
Eat mutant. Slippery isthmus, corpus and grinder.
DA707 C. elegans eat-17(ad707) X. Show Description
Eat mutant. Stuffs corpus and isthmus. Abnormality in m6 and m7 contraction timing. Displays clumping behavior; isolated in an RC301 background, so it's likely to have the RC301 bor-1 mutation.
DA726 C. elegans unc-10(e102) eat-13(ad522) X. Show Description
Unc. Eat mutant. Slippery pharynx-Slight relaxation defect.
DA837 Escherichia coli E. coli. Show Description
Bacteria. E. coli. Str-R. Uracil auxotroph. DA837 is derived from OP50. DA837 is harder for worms to eat than most E. coli strains. Some mild Eat mutant worms are easier to distinguish from WT when grown on DA837 than when grown on other E. coli strains. Biosafety Level: BSL-1.
DC19 C. elegans bus-5(br19) X. Show Description
Severe missense mutation. Bus (resistant to M. nematophilum), Bah (resistant to Yersinia biofilm formation), resistant to Leucobacter Verde2, hypersensitive to Leucobacter Verde1, drug and bleach sensitive. Slightly skiddy movement. Useful for drug screening. Reference: Xiong H, et al. Sci Rep. 2017 Aug 29;7(1):9839.
DCL569 C. elegans mkcSi13 II; rde-1(mkc36) V. Show Description
mkcSi13 [sun-1p::rde-1::sun-1 3'UTR + unc-119(+)] II. Germline rescue of the rde-1(mkc36) indel mutation, allowing germline-specific RNAi. Reference: Zou L, et al. Scientific Reports Volume 9, Article number: 2354 (2019) "Construction of a germline-specific RNAi tool in C. elegans."
DCR1017 C. elegans cima-1(wy84) IV; wyIs45 X; olaEx603. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx603 [rab-3p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx605 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR1023 C. elegans cima-1(wy84) IV; wyIs45 X; olaEx609. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx609 [aex-3p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx609 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR1078 C. elegans cima-1(wy84) IV; wyIs45 X; olaEx551. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx551 [cima-1p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx551 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR1099 C. elegans cima-1(wy84) IV; wyIs45 X, olaEx644. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx644 [ttx-3p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx642 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR1102 C. elegans cima-1(wy84) IV; wyIs45 X; olaEx647. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx647 [hlh-17p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx647 does not rescue AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR1288 C. elegans cima-1(wy84) IV; wyIs45 X; olaEx765. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx765 [dpy-7p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx765 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR1301 C. elegans cima-1(wy84) IV; wyIs45 X; olaEx775. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx775 [dpy-4p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx605 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR1337 C. elegans nsIs105 I; cima-1(wy84) IV; wyIs45 X; olaEx805. Show Description
nsIs105 [hlh-17p::GFP] I. wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx805 [hlh-17p::caspase12 + hlh-17p::caspase17 + ttx-3p::mCherry + glr-3p::mCherry + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Ablation of CEPsh glia partially suppresses AIY presynaptic maintenance defects in cima-1(wy84) mutants. nsIs105 (hlh-17::GFP) expression labels CEPsh glia. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR3791 C. elegans pfk-1.1(ola72) X. Show Description
Diffuse distribution of synaptic vesicle markers (SNB-1, CAT-1, and RAB-3) under hypoxic conditions. pfk-1.1(ola72) causes C562Y missense mutation. Reference: Jang et al. Neuron. 2016 Apr 20;90(2):278-91.
DCR936 C. elegans cima-1(wy84) IV; wyIs45 X; olaEx559. Show Description
wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx559 [rol-6p::cima-1 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx559 rescues AIY presynaptic defects in cima-1(wy84) mutants. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DG1856 C. elegans goa-1(sa734) I. Show Description
Recessive, early stop mutation within the coding sequence (C to T substitution in aa52) makes sa734 a likely null allele. May grow slightly better at 15C. Hyperactive, lays early stage eggs, increased amplitude of locomotort wave-form. Suppresses the lethargy and egg-laying defects of unc-43(n498). Reverses direction of locomotion more frequently than WT.
DG3226 C. elegans deps-1(bn124) I. Show Description
MAINTAIN AT 20 degrees C! deps-1 mutants are temperature-sensitive maternal-effect sterile (>80% sterile at 24.5C) and deps-1 M-Z- animals tend to lay many dead eggs and fewer eggs than WT at lower temps.
DH1300 C. briggsae Show Description
DH subclone of C. briggsae Zuckerman. This stock was maintained in liquid culture for some number of years, and has acquired mutations that have not been named or mapped. It is Unc, dauer-defective and ts lethal. Previously called C. briggsae BO.
DH261 C. elegans zyg-10(b261) III. Show Description
Temperature sensitive. Egg lethal. Abnormal first cleavage giving small P1 blastomere. Mutant is ts in late L4-early adult. Partial maternal (m,n).
DLM25 C. elegans hif-1(ia4) V; otIs197. Show Description
otIs197 [unc-14p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from unc-14 promoter in hif-1 mutant background for tissue-specific rescuing experiments. otIs197 rescues lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
DLM26 C. elegans hif-1(ia4) V; otEx3165. Show Description
otEx3165 [unc-120p::hif-1(P621A) + ttx-3p::RFP]. Non-degradable form of HIF-1 expressed from muscle-specific promoter in hif-1 mutant background for tissue-specific rescuing experiments. otEx3165 does not rescue lethality in hif-1 mutant animals exposed to 50ppm hydrogen sulfide. Reference: Topalidou I & and Miller DL. bioRxiv 174581; doi: https://doi.org/10.1101/174581.
DLW14 C. elegans unc-5(lib1[myo-3p::GFP(-) + unc-119(+) + myo-2p::GFP(Mos1)]) IV; krIs14 V. Show Description
krIs14 [hsp-16.48p::MosTransposase + lin-15(+) + unc-122p::GFP] V. Recessive Unc. unc-5(lib1) is a CRISPR/Cas9 engineered mutant carrying the Intersister/Intrachromatid Repair Assay (ICR Assay) cassette inserted into the endogenous unc-5 locus. Briefly, ICR assay cassette includes two tandem GFP cassettes: the upstream using the myo-3 (body wall) promoter with a truncated GFP coding sequence, and the down-stream using the myo-2 (pharynx) promoter with GFP coding sequence interrupted by a Mos1 Drosophila transposon. Excision of Mos1 yields a single DSB, which if repaired by intersister or intrachromatid recombination, then will yield GFP+ progeny. The krIs14 insertion carrying heat-shock inducible Mos1 transposase is marked with coelomocyte GFP expression. Reference: Toraason E, et al. Current Biology 2021. https://doi.org/10.1016/j.cub.2021.03.008
DM1017 C. elegans unc-52(e3003e998) II; ccar-1(ra5) IV. Show Description
Suppressed Unc-52. This strain was isolated after EMS mutagenesis of CB998 and subjected to whole-genome sequencing (Flibotte et al., Genetics 185: 431 - 441 (2010). In addition to the unc-52 and sup-38 mutations, it is homozygous for 300 other mutations determined from sequence data. All mutations are annotated in WormBase. The e3003 and e998 mutations were present in the original CB998 strain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00036200
DM1208 C. elegans unc-112(r367ra202) V. Show Description
Intragenic revertant (ra202) of original unc-112 mutation. WBPaper 00005804.
DM7059 C. elegans pha-1(e2123) III; raEx59. Show Description
raEx59 [F22B5.10::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7062 C. elegans pha-1(e2123) III; raEx62. Show Description
raEx62 [B0412.3::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7065 C. elegans pha-1(e2123) III; raEx65. Show Description
raEx65 [C53B4.3::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7066 C. elegans pha-1(e2123) III; raEx66. Show Description
raEx66 [F46F11.1::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7067 C. elegans pha-1(e2123) III; raEx67. Show Description
raEx67 [B0024.10::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7068 C. elegans pha-1(e2123) III; raEx68. Show Description
raEx68 [D2013.9::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7069 C. elegans pha-1(e2123) III; raEx69. Show Description
raEx69 [T06A10.3::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7070 C. elegans pha-1(e2123) III; raEx70. Show Description
raEx70 [ZK1236.7::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7071 C. elegans pha-1(e2123) III; raEx71. Show Description
raEx71 [K07G5.1::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7072 C. elegans pha-1(e2123) III; raEx72. Show Description
raEx72 [W06D4.1::GFP + pha-1(+) + rol-6(su1006)]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7073 C. elegans pha-1(e2123) III; raEx73. Show Description
raEx73 [F47F2.1::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7074 C. elegans pha-1(e2123) III; raEx74. Show Description
raEx74 [C52B11.2::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7085 C. elegans pha-1(e2123) III; raEx85. Show Description
raEx85 [T01G9.6::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7086 C. elegans pha-1(e2123) III; raEx86. Show Description
raEx86 [T10B11.6::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7088 C. elegans pha-1(e2123) III; raEx88. Show Description
raEx88 [ZK353.7::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7091 C. elegans pha-1(e2123) III; raEx91. Show Description
raEx91 [F42C5.9::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7092 C. elegans pha-1(e2123) III; raEx92. Show Description
raEx92 [F52A8.4::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7093 C. elegans pha-1(e2123) III; raEx93. Show Description
raEx93 [K07H8.1::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.
DM7106 C. elegans pha-1(e2123) III; raEx106. Show Description
raEx106 [ZK593.1::GFP + pha-1(+) + rol-6]. Temperature-sensitive pha-1 mutant rescued by extrachromosomal array carrying pha-1(+), dominant rol-6, and cDNA::GFP fusion driven by muscle promoter (T05G5.1). Grow at 25 degrees to maintain. At 15 degrees maintain by picking Rol-6 animals. WBPaper00038444.