More Fields
Strain Species Genotype
LP728 C elegans mig-5(cp385[mNG-GLO::AID::mig-5]) II. Show Description
FP knock-in. [NOTE: (4/1/2021) A lab has reported finding a second GFP insertion in LP728; it has not yet been confirmed whether or not it is present in the current CGC stock.] Reference: Heppert JK, et al. 2017 Genetics. In press.
LP858 C. elegans lea-1(cp431[mNG::3x FLAG::AID::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
LP860 C. elegans daf-2(e1370) III; lea-1(cp431[mNG::3x FLAG::AID::lea-1]) V. Show Description
Endogenous LEA-1 tagged at the C-terminus with mNG and AID* sequence for auxin-induced degradation. Maintain at 15C. Reference: Hibshman JD & Goldstein B. BMC Biol. 2021 Dec 14;19(1):263. doi: 10.1186/s12915-021-01176-0. PMID: 34903234
MDX44 C. elegans cylc-2(mon2[cylc-2::mNG::3xFLAG) I. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
NFB1722 C. elegans lag-1(vlc30[lag-1::T2A::mNG]) IV. Show Description
mNeonGreen tag inserted into endogenous lag-1 locus. Upstream flanking sequence: CCTACAAATCATTGGAACGACATGGACCGTGCAGAATTGTGTCCAATTAC. Downstream flanking sequence: TAGATTGGTCTCTCGCGGGATTACTGTATCTTTATATTGTCTCCTAATTT. Guide sequence: ATTACTAGATTCCACTCTCG. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334
NK2115 C. elegans cpIs121 I; rrf-3(pk1426) II; rde-1(ne219) V. Show Description
cpIs121 [lag-2p::mNG::PH::F2A::rde-1] I. Temperature-sensitive: maintain at 16-20C. RNAi-response variant. RNAi-hypersensitized DTC-specific RNAi strain that labels all rde-1(+) cells with mNeonGreen. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284.
NK2318 C. elegans dgn-1(qy18[dgn-1::mNG]) X. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2322 C. elegans cle-1 (qy22[cle-1::mNG+loxP]) I. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2324 C. elegans ina-1(qy23[ina-1::mNG]) III. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2326 C. elegans emb-9 (qy24[emb-9::mNG+loxP]) III. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2335 C. elegans lam-2(qy20[lam-2::mNG+LoxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2353 C. elegans agr-1 (qy27[agr-1::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2404 C. elegans epi-1(qy31[epi-1::mNG+loxP]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2413 C. elegans sdn-1(qy29[sdn-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2422 C. elegans him-4(qy33[him-4::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2425 C. elegans lam-3(qy28[lam-3::mNG+loxP]) I. Show Description
Superficially wild-type. Slow growth. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2436 C. elegans pat-3(qy36[pat-3::mNG]) III. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2442 C. elegans mig-6(qy37[mNG+loxP::mig-6]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2443 C. elegans nid-1(qy38[nid-1::mNG+loxP]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2444 C. elegans pxn-2(qy39[pxn-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2445 C. elegans pxn-1(qy40[pxn-1::mNG+loxP]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2456 C. elegans ddr-1(qy43[ddr-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2457 C. elegans ddr-2(qy44[ddr-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2477 C. elegans ptp-3(qy47[ptp-3::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2479 C. elegans pat-2(qy49[pat-2::2xmNG]) III. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2500 C. elegans unc-52(qy53[unc-52::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2502 C. elegans ten-1(qy56[ten-1::mNG+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2503 C. elegans rap-3(qy57[rap-3::mNG]) IV. Show Description
Superficially wild-type. Reference: Jayadev R, et al. J Cell Biol. 2019 Aug 6. pii: jcb.201903124. doi: 10.1083/jcb.201903124.
NK2555 C. elegans unc-52(qy75[mNG+loxP::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2557 C. elegans mig-6(qy73[mig-6::mNG+loxP]) V. Show Description
Superficially wild-type. Specifically tags the long isoform of mig-6. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2565 C. elegans pxn-2(qy76[mNG+loxP::pxn-2]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2579 C. elegans fbl-1(qy62[mNG+loxP::fbl-1]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2580 C. elegans spon-1(qy30[spon-1::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2581 C. elegans gpn-1(qy35[gpn-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2582 C. elegans lon-2(qy55[lon-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2583 C. elegans unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2590 C. elegans gon-1(qy45[gon-1::mNG+loxP]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NM5161 C. elegans jsTi1453 I; bqSi711 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. jsTi1453 is an RMCE landing site inserted using miniMos on Chr I at 11,933,068 ( at 13.1 m.u.) between R06C1.4 and R06C1.6. Insertion site ccctactatcaacgcaaaaactatttggcttttactTAaacataacgttttgaatttgaaaatcaaaaag with rpl-28p trancription toward R06C1.4. bqSi711 expresses nNeonGreen in germline and early embryo. Reference: Nonet ML. Genetics. 2020.
NM5322 C. elegans jsSi1570 I; bqSi711 IV. Show Description
jsSi1570 [delta_mosL::loxP::rpl-28::FRT::GFP::his-58::FRT3::mosR] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chromosome I. Derivative of jsTi1453 lacking the left mos1 arm.
NM5402 C. elegans jsSi1579 II; bqSi711 IV. Show Description
jsSi1579 [loxP::rpl-28p::FRT::GFP::his-58 FRT3] II. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
NM5471 C. elegans jsSi1669 IV. Show Description
jsSi1669 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3’ rpl-28p::FRT::GFP::his-58::FRT3] IV. Single component RMCE landing site on Chr IV adjacent to the site of the commonly used ttTi10882 MosSCi insertion site.
NM5500 C. elegans jsSi1691 II. Show Description
jsSi1691 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3' rpl-28p::FRT::GFP::his-58::FRT3] II. Single component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
OH14888 C. elegans daf-16(ot853[daf-16::mNG::3xFlag::AID]) I; ieSi57 II; daf-2(e1370) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted
OH15845 C. elegans daf-16(ot853[daf-16::mNG::AID]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
PHX1812 C. elegans cfi-1(syb1812[cfi-1(delta_enhancer)::mNG::AID]) I. Show Description
A4e enhancer was deleted in endogenously-tagged cfi-1(kas16[mNG::AID::cfi-1]). Expression of cfi-1::mNG::AID is lost in VNC motor neurons. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.
PHX1856 C. elegans cfi-1(syb1856[cfi-1(mut_COE)::mNG::AID]) I. Show Description
Eight COE motifs in A4e were mutated in endogenously-tagged cfi-1(kas16[mNG::AID::cfi-1]). Expression of cfi-1::mNG::AID is down-regulated in late larval stages and adults. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.
UTR43 C. elegans par-4(nar12[par-4Ap::mNG + loxP sqt-1(gf) Hygromycin(+) loxP 3X FLAG]) V. Show Description
Homozygous viable, Rol. nar12 (non-excised strain) is null for par-4A & C, but not for par-4B, and is viable. Low rate of spontaneous excision even when maintained at 15C. Pick Rollers to maintain. Reference: Roy et al. microPublication Biology.
UTR45 C. elegans par-4(nar13[mNG::3X FLAG::par-4a + loxP]) V. Show Description
Superficially wild-type. nar13 was derived by excision of UTR43(nar12) cassette by heat shock. Tagged endogenous PAR-4A & C: weak, ubiquitous fluorescence. Reference: Roy et al. microPublication Biology.
VBS663 C. elegans nrde-2(gg95) vbaIs53 II; eri-1(mg366) IV. Show Description
vbaIs53 [rps-27p::mNeonGreen::Flag::nrde-3] II. Maintain at 20C or cooler; germline mortal (Mrt) at 25C. mNG::NRDE-3 localizes to the cytoplasm. Upon introduction of dsRNA, mNG::NRDE-3 labels transcription sites of dsRNA gene targets. Superficially wild-type. Reference: Toudji-Zouaz A, et al. Nucleic Acids Research. 2021 Jun 9;gkab469. doi: 10.1093/nar/gkab469. PMID: 34107044.