More Fields
Strain Species Genotype
AD294 C. elegans cylc-2(mon2[cylc-2::mNG::3xFLAG) I; him-5(e1490) V. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
BN617 C. elegans bqSi294 II; bqSi614 IV. Show Description
bqSi294 [hsp16.41p::FRT::mCherry::his-58::FRT::GFP::his-58 + unc-119(+)] II; bqSi614 [dat-1p::FLP D5::SL2::mNG + unc-119(+)] IV. Heat shock produces green nuclei in dopaminergic neurons and red nuclei elsewhere. Constitutive expression of diffusible mNeonGreen in dopaminergic neurons can mask GFP::HIS-58 signal.
BN711 C. elegans unc-119(ed3) III; bqSi711 IV. Show Description
bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Constitutive co-expression of codon-optimised FLP and fluorescent mNeonGreen in the germ line. Reference: Macias-Leon J & Askjaer P. (2018): Efficient FLP-mediated germ-line recombination in C. elegans. Micropublication:biology. Dataset. https://doi.org/10.17912/W2G66S
BN908 C. elegans unc-119(ed9) III; bqSi908 IV. Show Description
bqSi908 [UAS::FLP::SL2::mNG + unc-119(+)] IV. Strain for inducible co-expression of codon-optimised FLP recombinase and fluorescent mNeonGreen by cGAL (GAL4 optimised for C. elegans). Reference: Ayuso C & Askjaer P. Spatiotemporal control of genome recombination through combined FLP-Frt and GAL4-UAS technologies. microPublication Biology. https://doi.org/10.17912/MICROPUB.BIOLOGY.000089.
DG4218 C. elegans cpg-1(tn1728[mng::3xflag::cpg-1]) III. Show Description
Superficially wild type
DV3208 C. elegans daf-15(re147[daf-15::mNG::2xHA]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus. Ubiquitous expression.
DV3525 C. elegans daf-15(re257[daf-15::mNG::AID]) IV. Show Description
mNeonGreen tag inserted at 3' end of endogenous daf-15 locus; AID at 3' end of mNeonGreen. Ubiquitous expression. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin.
FDU1056 C. elegans mig-17(shc19[mig-17::mNG +LoxP]) V. Show Description
C-terminus of endogenous mig-17 locus tagged with mNeonGreen using CRISPR/Cas9. Reference: Fan J, et al. Elife. 2020 Apr 7;9:e55890. PMID: 32255430
GLW16 C. elegans rab-7(utx12[mNG::rab-7]) II. Show Description
Superficially wild-type. N-terminal tag of RAB-7 via CRISPR/Cas9 knock-in of mNeonGreen at rab-7 locus. Insertion verified by PCR. Left flank: 5' gcacaacaaaaaggcttccagtgaacaaaa 3'; Right flank: 5' ATGTCGGGAACCAGAAAGAAGGCGCTGCTC 3'. sgRNA: 5' cttccagtgaacaaaaATGT 3'
GLW19 C. elegans mpk-1(utx14[mNG::mpk-1]) III. Show Description
Superficially wild-type. N-terminal tag of MPK-1 via CRISPR/Cas9 knock-in of mNeonGreen at mpk-1 locus. Insertion verified by PCR. Left flank: 5' tagaaatttaaaattcatttcttcttgcag 3'; Right flank: 5' ATGGCCGACGGAGAAGCGGTTATCTCGACG 3'. sgRNA: 5' ttcttcttgcagATGGCCGA 3'
GLW2 C. elegans attf-2(utx2[mNG::attf-2]) V. Show Description
Superficially wild-type. N-terminal tag of ATTF-2 via CRISPR/Cas9 knock-in of mNeonGreen at attf-2 locus. Insertion verified by PCR. Left flank: 5' cttttttgctcacatcatcatttttcagtc 3'; Right flank: 5' ATGTCGGCCGAGACCGCGACTATCCCCGAAGTTTC 3' (5 silent mutations). sgRNA: 5' CGAAACTGCAACCATACCCG 3'
GLW25 C. elegans daf-18(utx19[mNG::3xFlag::daf-18]) IV. Show Description
Superficially wild type. N-terminal tag of DAF-18 via CRISPR/Cas9 knock-in of mNeonGreen at daf-18 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcagtttccaggtacatctactaaccccca 3'; Right flank: 5' ATGGTTACTCCTCCTCCAGATGTGCCAAGC 3'; sgRNA: GGAGGAGGAGTAACCATtgg; Cas9/sgRNA plasmid: pGLOW27; mNG^SEC^3xFlag plasmid: pGLOW53; SEC insertion allele strain: GLW24. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW33 C. elegans T28D6.6(utx25[T28D6.6::mNG::3xFlag]) III. Show Description
Superficially wild type. C-terminal tag of T28D6.6 via CRISPR/Cas9 knock-in of mNeonGreen at T28D6.6 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gtcgcaaataatggttttttttccagAGTC 3'; Right flank: 5' TAAgctgaaattcccgtgcttctcgtcttc 3'; sgRNA: gggaatttcagcTTAGACTc; Cas9/sgRNA plasmid: pGLOW2; mNG^SEC^3xFlag plasmid: pGLOW42; SEC insertion allele strain: GLW32. Reference: Huang et al. 2021. Improved CRISPR/Cas9 knock-in efficiency via the self-excising cassette (SEC) selection method in C. elegans. 2021 Sep 16;2021:10.17912/micropub.biology.000460. doi: 10.17912/micropub.biology.000460. eCollection 2021.
GLW4 C. elegans gyf-1(utx4[gyf-1::mNG]) II. Show Description
Superficially wild-type. C-terminal tag of GYF-1 via CRISPR/Cas9 knock-in of mNeonGreen at gyf-1 locus. Insertion verified by PCR. Left flank: 5' CCATCGGCTCCGGTGAATCCTTCGCGCCGT 3'; Right flank: 5' TAGatgagtcatttctttttccagctttaa 3'. sgRNA: 5' TGACTCATCTAACGGCGCGA 3'
GLW6 C. elegans W08E12.7(utx6[mNG::W08E12.7]) IV. Show Description
Superficially wild-type. N-terminal tag of W08E12.7 via CRISPR/Cas9 knock-in of mNeonGreen at W08E12.7 locus. Insertion verified by PCR. Left flank: 5' ttcaatgtttattctttcagatagatcaaa 3'; Right flank: 5' ATGGTTAGAAAGGACAGTGAGAGTAGTTGTTCAAGTGATGG 3' (6 silent mutations). sgRNA: 5' GAAAGCAGCTGCTCCAGCGA 3'
GLW8 C. elegans eel-1(utx8[mNG::eel-1]) IV. Show Description
Slow growing. N-terminal tag of EEL-1 via CRISPR/Cas9 knock-in of mNeonGreen at eel-1 locus. Insertion verified by PCR. Left flank: 5' gacaagcgggttttttgaatcgtttcgaaa 3'; Right flank: 5' ATGAAGATTGACGATGCTGAGCCGAGCTCTAGTTCATCGGGCTCCGATAT 3' (6 silent mutations). sgRNA: 5' GACCCGGAAGAGCTTGAACT 3'
KRA345 C. elegans cfi-1(kas16[mNG::AID::cfi-1]) I. Show Description
mNeonGreen and AID tags inserted into endogenous cfi-1 locus. Transgene can be degraded in a background expressing TIR1 co-factor supplemented with auxin. Reference: Li Y, et al. Elife. 2020 Oct 1;9:e59464. doi: 10.7554/eLife.59464. PMID: 33001031.
KRA467 C. elegans lin-39(kas9[lin-39::mNG::AID]) III. Show Description
mNeonGreen::3xFLAG::AID was inserted at the C-terminus of the endogenous lin-39 locus by CRISPR. Endogenous lin-39 expression marked by mNG. LIN-39 protein can be degraded by Auxin application with expression of TIR-1 protein. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
LP212 C. elegans pkc-3(cp41[mNeonGreen:3xFlag::pkc-3 + LoxP]) II. Show Description
mNG::aPKC endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP216 C. elegans par-6(cp45[par-6::mNeonGreen::3xFlag + LoxP unc-119(+) LoxP]) I; unc-119(ed3) III. Show Description
PAR-6::mNG endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP242 C. elegans par-3(cp54[mNeonGreen::3xFlag::par-3]) III. Show Description
mNG::PAR-3 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP362 C. elegans gex-3(cp114[mNG-C1^3xFlag::gex-3]) IV. Show Description
mNG:GEX-3 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP373 C. elegans mex-5(cp125[mNG-C1^3xFlag::mex-5]) IV. Show Description
mNG::MEX-5 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP393 C. elegans oma-2(cp145[mNG-C1^3xFlag::oma-2]) V. Show Description
mNG::OMA-2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP399 C. elegans rap-1(cp151[mNG-C1^3xFlag::rap-1]) IV. Show Description
mNG::RAP-1 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP435 C elegans apr-1(cp166[mNG-C1^3xFlag::apr-1]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP439 C elegans nud-2(cp170[nud-2::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP443 C elegans klp-17(cp174[klp-17::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP447 C elegans klp-7(cp178[klp-7::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP451 C elegans bicd-1(cp180[mNG-C1^3xFlag::bicd-1]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP521 C elegans klp-12(cp234[klp-12::mNG-C1^3xFlag]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP527 C elegans mes-1(cp240[mes-1::mNG-C1^3xFlag] X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP530 C elegans cam-1(cp243[cam-1::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP538 C. elegans gsk-3(cp251[gsk-3::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP559 C. elegans mom-2(cp267[mom-2::mNG-C1^3xFlag]) V. Show Description
FP fusion. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP560 C elegans dhc-1(cp268[dhc::mNG-C1::3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP563 C elegans dnc-1(cp271[dnc::mNG-C1::3xFlag]) IV. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP585 C elegans lin-5(cp288[lin-5::mNG-C1^3xFlag]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP591 C elegans lis-1(cp294[lis-1::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP598 C elegans dlg-1(cp301[dlg-1::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP600 C elegans klp-4(cp303[klp-4::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP604 C elegans klp-8(cp307[klp-8::mNG-C1^3xFlag]) X. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP608 C elegans klp-20(cp311[klp-20::mNG-C1^3xFlag]) III. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP637 C. elegans par-2(cp329[mNG-C1^par-2]) III. Show Description
mNG::PAR-2 endogenously tagged using Cas9-triggered homologous recombination. Reference: Dickinson DJ, et al. Dev Cell. 2017 Aug 21;42(4):416-434.e11. (PMID 28829947).
LP697 C. elegans mom-5(cp367[mom-5::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP705 C elegans dsh-1(cp375[dsh-1DIX::mNG-C1^3xFlag::PDZ,DEP]) II. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP713 C elegans pry-1(cp383[pry-1::mNG-C1^3xFlag]) I. Show Description
FP knock-in. Reference: Heppert JK, et al. 2017 Genetics. In press.
LP728 C elegans mig-5(cp385[mNG-GLO^AID::mig-5]) II. Show Description
FP knock-in. [NOTE: (4/1/2021) A lab has reported finding a second GFP insertion in LP728; it has not yet been confirmed whether or not it is present in the current CGC stock.] Reference: Heppert JK, et al. 2017 Genetics. In press.
MDX44 C. elegans cylc-2(mon2[cylc-2::mNG::3xFLAG) I. Show Description
Endogenous cycl-2 locus tagged with mNeonGreen (mNG). Green fluorescence in sperm. Him. Reference: Krauchunas AR, et al. (2020). C. elegans CYLC-2 localizes to sperm. microPublication Biology. 10.17912/micropub.biology.000314.
NK2115 C. elegans cpIs121 I; rrf-3(pk1426) II; rde-1(ne219) V. Show Description
cpIs121 [lag-2p::mNG::PH::F2A::rde-1] I. Temperature-sensitive: maintain at 16-20C. RNAi-response variant. RNAi-hypersensitized DTC-specific RNAi strain that labels all rde-1(+) cells with mNeonGreen. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284.