More Fields
Strain Species Genotype
KK96 C. elegans unc-4(e120) mix-1(b285) sqt-1(sc13)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
mix-1(b285) is maternal effect lethal. Heterozygotes are WT and segregate WT, Unc-4 worms which are strong Egl, and paralyzed Dpy Uncs.
KP2932 C. elegans lin-23(nu412)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
KS100 C. elegans egl-27(ok151)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Egl and DpyUnc. Temperature sensitive Egl. Do not grow at 15C.
LB10 C. elegans nuo-1(ua1)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Paralyzed Uncs and L3 lethals. ua1 is a deletion of the first 3 full exons of the NADH-ubiquinone oxidoreductase of complex I in the mitochondrial respiratory chain.
MG8 C. elegans csc-1(t1171) dpy-2(e8)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-3(e1147) IV. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and Dpys which give only dead eggs. Throws males.
ML335 C. elegans dpy-2(e489) mcDf1 unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, dead eggs and DpyUncs. mcDf1 homozygotes arrest as dead eggs.
ML581 C. elegans lin-26(mc15) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate dead eggs, DpyUncs and WT. lin-26(mc15) is a molecular null due to a deletion of most of lin-26 coding sequence.
ML610 C. elegans lir-1(mc33) mcDf3/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and dead eggs. mcDf3 is a deficiency very closely linked to lir-1 - not separable - which removes approx. 250 kb.
ML93 C. elegans dpy-2(e489) lin-26(mc1) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and dead eggs (mc1 homozygotes). mc1 is a strong loss of function mutation, but probably not null. mc1 is an embryonic lethal mutation with degeneration of hypodermal cells.
MT11826 C. elegans sqv-7(n3789)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and Sqv which are sterile (probably Mel). The bases 17746 to 19294 of the C52E12 cosmid sequence are deleted and 19295 to 19316 are duplicated. The N terminal 239 bases of coding sequence for sqv-7 are left intact; they are predicted to encode 79 amino acids (of 329 amino acids total) of SQV-7 (followed by a frameshift).
MT13664 C. elegans nurf-1(n4293)/mnC1 [dpy-10(e128) unc-52(e444)] II; lin-15B&lin-15A(n765) X. Show Description
n4293: F26H11.2 deletion. 724 bp deletion of splice donor of exon 1 and all of exon 2. Heterozygotes are Muv. Segregates Muv, Ste, and Dpy Uncs.
MT20110 C. elegans unc-4(e120) rol-1(e91)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. Show Description
nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Rol; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.
MT20111 C. elegans unc-4(e120) bli-1(e769)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II. Show Description
nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1. Heterozygotes are WT. Segregates WT GFP+ and Egl Unc Bli; no Dpy Uncs are seen as nIs190 mnC1 homozygotes are embryonic lethal.
MT3316 C. elegans lin-4(e912)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
MT4156 C. elegans lin-26(n156)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-5(e1490) V. Show Description
Heterozygotes are WT and segregate WT, Egls with abnormal tails and DpyUncs.
MT5823 C. elegans lin-26(n156) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II; him-5(e1490) V. Show Description
Heterozygotes are WT.
MT7480 C. elegans sqv-8(n2825)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sqvs which have and abnormal vulva from mid-L4 and are somewhat sterile.
MT7483 C. elegans sqv-8(n2822)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Sqvs which have and abnormal vulva from mid-L4 and are sterile.
MT8191 C. elegans snt-1(md290) unc-104(e1265) II/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Unc, and paralyzed Dpy Uncs. Reference: Jorgensen EM, Nature. 1995 Nov 9;378(6553):196-9.
MT9088 C. elegans sqv-7(n2844) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, UncSqv and DpyUncs. n2844: mid-L4 vulva abnormal, sterile.
MT9940 C. elegans dpl-1(n3316) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. n3316 is Mel. 1422 bp deletion removes cosmid T23G7 nt 5200-6621.
NG2295 C. elegans hlh-14(gm34)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and arrested larvae (hlh-14 homozygotes).
NJ549 C. elegans dpy-10(e128) unc-104(rh142)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Severe unc-104 allele, hypercontracted coiler. Dpy heterozygotes segregate Dpy, mnC1 dpy-10 unc-52 homozygotes (paralyzed Dpy), and very small and sick dpy-10 unc-104 homozygotes.
NL344 C. elegans gpb-1(pk44)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
OK245 C. elegans pyr-1(cu8) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles (mnC1 homozygotes), and Unc-4 animals which have a partially penetrant Mel phenotype.
OT125 C. elegans mua-9(rh197)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregates WT, DpyUncs and Mua. rh197 animals are inviable as homozygotes.
PD7217 C. elegans let-852(cc504) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.
PD7218 C. elegans let-853(cc505) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.
PD7220 C. elegans let-854(cc507) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, paralyzed Dpys and dead eggs. cc507 is a recessive embryonic lethal.
PD7222 C. elegans let-855(cc509) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.
PD7227 C. elegans let-856(cc514) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.
PD7229 C. elegans let-857(cc516) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, paralyzed Dpys and embyronic lethals.
PD7244 C. elegans let-856(cc529) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, paralyzed Dpys and Unc-4s which arrest as larval lethals.
PD8662 C. elegans lin-31(n301) hlh-1(cc450)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc (mnC1 homozygotes) and larval lethals (lin-31 hlh-1 homozygotes). The lin-31 hlh-1 homozygotes are very Dpy and Lumpy and look like they hatched just after reaching the two-fold stage. See also WBPaper00001975.
PJ801 C. elegans jDf1/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are Unc (Paralyzed adult) and segregate more Uncs, DpyUncs and dead eggs. Growth slow. Pick Unc to maintain. Crossover suppressed.
PJ803 C. elegans jDf2/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are Unc (Paralyzed adult) and segregate more Unc, DpyUnc and dead eggs. Pick Unc to maintain. Balanced well.
PK172 C. elegans ptc-1(ok122) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, paralyzed Dpys, and Uncs which are sterile (with 1-2 escaper progeny). ptc-1 homozygotes have multinucleate germ cells (both sperm and oocytes). ptc-1 homozygotes have an underproliferated germline.
PS1410 C. elegans let-23(sy15) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1423 C. elegans let-23(sy17) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Unc larval lethals. Reference null allele for let-23. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS1524 C. elegans let-23(sa62) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
10% of heterozygotes are Muv, 90% are WT. Segregates UncMuv and DpyUncs. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS295 C. elegans let-23(sy97) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozgyotes are WT and segregate WT, DpyUncs and Vulvaless Unc-4s. sy97 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS302 C. elegans let-23(sy10) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUnc and Sterile Unc-4s. sy10 is only 15% viable. Maintain by picking WT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS3411 C. elegans cog-1(sy607)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, DpyUncs and Pvul Sterile cog-1 homozygotes. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
PS4064 C. elegans let-23(sy621sa62) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
RG3066 C. elegans snpc-1.1(ve566[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain PD1074. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 dead larvae (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+ animals. Left flanking Sequence: agattaataaaataacaaaagtcggagatg ; Right flanking sequence: gcgggaaccagcggtattcaacgcatttca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3090 C. elegans dhps-1(ve590[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous Ste. Deletion of 4636 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+, Sterile GFP+ non-mKate2 (ve566 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tttttcagaaacttgctccaaaATGAGCAC ; Right flanking sequence: agGAGTCGTAAAACACCACATCAACAACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3106 C. elegans rpa-1(ve606[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1[dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval arrest. Deletion of 2554 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve606 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttctacgccattttttttggcgcgtatccg ; Right flanking sequence: atccacaatcgctgattttgtacaatgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3142 C. elegans gtf-2E2(ve642[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1[dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous larval lethal. Deletion of 1631 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve642 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaaaataacttgaaacttcaaaagaaata ; Right flanking sequence: TTCGCTTTTGCTGCTTCTGAAGAGTATGTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3147 C. elegans T14B4.3(ve647[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygous sterile. Deletion of 1115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve647 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaccaatgctgatgaaatcaacttccacgg ; Right flanking sequence: GATGGGTAGACAGAAGAAAGATTAGaatta. sgRNA #1: caagagaacttgaaactccg; sgRNA #2: GATCCTGGTTCGACTATCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3154 C. elegans T26C5.5(ve654[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mnC1 [dpy-10(e128) unc-52(e444) umnIs37] II. Show Description
umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Homozygotes are unhealthy, lay small broods. Deletion of 696 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 unhealthy animals (ve654 homozygotes) and paralysed DpyUnc non-GFP mKate2+ (mnC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcactacattgcctcCTAACATGTCCTTCC ; Right flanking sequence: gggggtttcctctttctttctttttaaaga. sgRNA #1: ATACATATTATTGGATTGGA; sgRNA #2: attgaaatggagaaggacgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.