MT13650 |
C. elegans |
mir-48(n4097) V. Show Description
Worms are weakly retarded, with cold-sensitive supernumerary adult-stage molt phenotype (<5% at 20C, about 70% at 15C). 293 bp deletion encompassing the mir-48 gene. mir-48 is at 5908 to 5885 of F56A12. Deletion goes from -45 to +248 from start of mir-48.
|
|
MT13652 |
C. elegans |
mir-48(n4097) V; mir-84(n4037) X. Show Description
Worms exhibit supernumerary adult-stage molt and are often unable to exit the molt, becoming trapped in the cuticle.
|
|
VT1064 |
C. elegans |
mir-48(n4097) maIs105 V; mir-84(n4037) X. Show Description
maIs105 [col-19::GFP]. Retarded heterochronic phenotype. Worms exhibit supernumerary adult-stage molt and are often unable to exit the molt, becoming trapped in the cuticle. col-19::GFP expression is reduced in hyp7 at the L4 molt. n4037 deletion is between 2891 and 3682 of clone B0395. mir-84 is at 3351-3330 in B0395.
|
|
CGC152 |
C. elegans |
mir-48(umn59[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::Lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9. Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
|
|
CGC153 |
C. elegans |
mir-48(umn60[mir-48p+SL1::EGL-13NLS::mScarlet-I::cMycNLS::linker::mODC(422-461)(E428A/E430A/E431A):: lox511I::let-858 3'UTR]) V. Show Description
Nuclear mScarlet-I was inserted in place of the endogenous mir-48 pre-miRNA via CRISPR/CAS9. Left Flanking: CACAGGTAAGTCAATTAACCAATTG, Right Flanking: TTATTATTATGTTTCATTCAATAAC. sgRNA: GGGAATGCGAGCTAGGCTGG.
|
|
CT18 |
C. elegans |
zaEx19. Show Description
zaEx19 [mir-48::GFP + rol-6(su1006)]. Pick GFP+ to maintain. The GFP+ animals may not always express the Roller phenotype.
|
|
MT13669 |
C. elegans |
nDf51 V. Show Description
Retarded heterochronic phenotype. Worms reiterate L2-stage programs, have extra seams cells, gapped alae, and >30% burst at the vulva at the L4 molt. Phenotype suppressed post-dauer. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
MT14748 |
C. elegans |
nDf51 V; nEx1184. Show Description
nEx1184 [sur-5::GFP]. Maintain by picking GFP+. nEx1184 rescues the lethality and extra seam cells in nDf51. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
MT14778 |
C. elegans |
nDf51 V; nEx1192. Show Description
nEx1192 [sur-5::GFP]. Maintain by picking GFP+. nEx1192 does not rescue the lethality and extra seam cells in nDf51. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1066 |
C. elegans |
nDf51 V; mir-84(n4037) X. Show Description
Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1102 |
C. elegans |
lin-28(n719) I; lin-46(ma164) nDf51 V; mir-84(n4037) X. Show Description
Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1103 |
C. elegans |
lin-28(n719) I; nDf51 V; mir-84(n4037) X. Show Description
Precocious heterochronic phenotype, omission of L2-stage program resulting in fewer seam cells by the L3 stage worms. Precocious alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1142 |
C. elegans |
nDf51 V; mir-84(n4037) X; ctIs39. Show Description
ctIs39 [hbl-1::GFP + rol-6(su1006)]. Rollers and GFP+. Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. ctIs39 [hbl-1::GFP]: integrated reporter codes for 133 amino acids of HBL-1 followed by GFP, and contains 1.4 kb of hbl-1 3' UTR plus an NLS. hbl-1::GFP is elevated in the hypodermal syncytium at the L3 stage. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1143 |
C. elegans |
lin-41(ma104) I; nDf51 V; mir-84(n4037) X. Show Description
Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1145 |
C. elegans |
lin-46(ma164) nDf51 V; mir-84(n4037) X. Show Description
Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. Vul. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT1146 |
C. elegans |
nDf51 V; hbl-1(ve18) mir-84(n4037) X. Show Description
Weak retarded heterochronic phenotype with incomplete alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
|
|
VT3297 |
C. elegans |
maIs105 V; mir-793(ma292) X. Show Description
maIs105 [col-19::GFP] V. mir-793(ma292) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma292 allele is missing the 220 nucleotide region between ACCGAGCAAGTTAGAAATCACCGCC and GTATGAATGTTTTTCCTTCAAACAT [chrX:13,857,855-13,858,124 of WBcel235/ce11].
|
|
VT3299 |
C. elegans |
mir-795(ma298) I; maIs105 V. Show Description
maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11].
|
|
VT3301 |
C. elegans |
mir-794 mir-795(maDf5) I. Show Description
mir-794 mir-795(maDf5) enhances retarded phenotypes of mir-48 mir-241 (nDF51). maDf5 allele is missing the 1312 nucleotide region between ATACATATTCCGAGAAACGTTACCT and GTGAGGCGCCAAATGCCGGCCTCAC [chrI:12,594,556-12,595,917 of WBcel235/ce11].
|
|
CGC154 |
C. elegans |
mir-4812(umn61[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-4812 pre-miRNA deletion allele in which mir-1824 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
MLC425 |
C. elegans |
mir-4813(luc21) III. Show Description
Superficially wild-type. CRISPR/Cas9-engineered mir-4813 seed mutant: ttcaatat to tGCGCat (introduced FspA1 cutting site) and inserted additional PAM mutation in the upstream region.
|
|
MLC603 |
C. elegans |
lucEx421. Show Description
lucEx421 [mir-4813p::myr::GFP::unc-54 3UTR + ttx-3p::mCherry]. Pick mCherry+ animals to maintain. Reporter contains 1kb upstream mir-4813 promoter sequence and 1kb unc-54 3UTR downstream sequence. Provides a marker for pharyngeal muscle cell-cell fusion. Reference: Gutie?rrez-Pérez, P. et al. A deeply conserved miR-1 dependent regulon supports muscle cell physiology. bioRxiv, 2020, doi.org/10.1101/2020.08.31.275644.
|
|
VT1259 |
C. elegans |
unc-119(ed3) III; maIs150. Show Description
maIs150 [mir-48p::GFP + unc-119(+)]. Wild type.
|
|