Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
MT14673 C. elegans mir-359(n4540) X. Show Description
Deletion breakpoints are: TGTTTTATAGAAAGCTGAGGGTGTGTGTGTGTG / CCAGATGG_GTAAGTGAATT / GTTTTGTGTAGATGGTGGAAATGAGCAGGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
CGC142 C. elegans mir-359(umn49[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-359 pre-miRNA deletion allele in which mir-359 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
VL429 C. elegans unc-119(ed3) III; wwEx25. Show Description
wwEx25 [mir-359p::GFP + unc-119(+)]. Maintain by picking non-Unc.