More Fields
Strain Species Genotype
MT15454 C. elegans mir-243(n4759) IV. Show Description
Deletion breakpoints are:CAGAGATCGTGTGACAAT / GACGTTGACGCGAAGAAG.... GAGTAGTGTAATTTCCAATTTTTAT / AGATTAATTCAGGGGTGGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15517 C. elegans mir-233(n4761) X. Show Description
Deletion breakpoints are:TTGAAGTTGCTCCGGACAAAAA / GCAGCCATCAGTCT...TCTCTCCAAGGTTGTA / ACAGGAGACGACGACCACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15563 C. elegans nDf53 III; mir-58.1(n4640) IV; nDf54 X. Show Description
Sick strain. mir-80 and mir-227 are deleted in nDf53. mir-81, mir-82, T02D1.2 are deleted in nDf54. Deletion breakpoints for n4640 are:CCGGCCAAATCTAGAACTGC / AAGAGTACGGTCTTG...GACTGAGCTAGAGTG / ACCTCTGATAATACGGAACGG. Deletion breakpoints for nDf53 are: ACTCATTTCGTTCGCCAGAAATTC / TCAGTTTGTGTA...ATAGCAGAGGT / ATTAGGAGAGTATAGACATCGAAAGCA. Deletion breakpoints for nDf54 are AAAATTTTTAAATTCTGAAATTAG / TTAAAAAACTGG...ATGAGTGGCAAA / AACTGATTGTGAGTAATTGTCATCTTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15767 C. elegans mir-258.2(n4797) X. Show Description
Deletion breakpoints are:ATCAAAGTGAACAAATACG / TGCTCTTCTCCATAACCAAC...CGGCGAATTCCTTATGATTTG / GTCTCTCTTTTGTAGTATGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15873 C. elegans mir-240(n4541) X. Show Description
Deletion breakpoints are:TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT15981 C. elegans mir-87(n4104) V; mir-233(n4761) X. Show Description
Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16033 C. elegans mir-244(n4367) I. Show Description
Deletion breakpoints are: CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16060 C. elegans nDf64 V. Show Description
mir-253 and part of F44E7.5 are deleted in nDf64. Deletion breakpoints are:GATATCCTCACACTTTGGCAAAGAGTGCTT / GTTGAAGACGGTGAAAACATCCGAATTTTCAGGGAAGTT...TGAGATAAGAACACAAA GAATTCGATTTTC / GTGAATTCTGAACGAAACTTTACGTTTTGGACAGTAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16061 C. elegans mir-238(n4112) III; nDf62 X. Show Description
4x outcrossed autosomes; 2x outcrossed X chromosome. Homozygous by PCR. Reference: Curr Bio (2010) 20:367-73.
MT16308 C. elegans mir-252(n4570) II. Show Description
Deletion breakpoints are:TGTTGCACAATAAATTCTCAAACTTTTGTG / TTTCCGTAATAA...AGTGAATTGAAA / GAGCCGGTGTGGAGTGGGGCGGTTCTCGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16309 C. elegans mir-247&mir-797(n4505) X. Show Description
Deletion breakpoints are: CCAGTGTTACCACCGCTTGCTACAAACGGC / AAAAAATTTGAA...CAAAAATTTAT / CACATGAAATTATACCAAACAGTCAAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16310 C. elegans mir-269(n4641) IV. Show Description
Deletion breakpoints are:CCGTTTGCGAGTCGCGGT / GTTGCTCATTGTGCCCGAT...TCCAACTTCTGAC / CCAAGTCAATATTTTTCAGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16317 C. elegans mir-252(n4570) II; mir-251(n4606) X. Show Description
Deletion breakpoints for n4606 are:TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Deletion breakpoints for n4570 are:TGTTGCACAATAAATTCTCAAACTTTTGTG / TTTCCGTAATAA...AGTGAATTGAAA / GAGCCGGTGTGGAGTGGGGCGGTTCTCGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16335 C. elegans mir-251(n4606) X. Show Description
Deletion breakpoints are:TGGCTAATCGGTAAAATGGT / CGGCTGACGGCTAATTCGG...AGTTTCAACAATTTTTTC / GGGCGAGAAGCGACTAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16337 C. elegans mir-245(n4798) I. Show Description
Deletion breakpoints are:AACCTTAATAAACAAATTTTA / TTAGATTTGTTTCTGAA...GATAGTGACTTTCTTGAC / AAAACTTCCTAGCGCCATCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16494 C. elegans mir-229&mir-64&mir-65&mir-66(nDf63) III. Show Description
Deletion breakpoints are: TATTTGCCAAAAATGGAAATTTT / CGGCAAATCGGGAAGCC...AGCTCGTCGGAAGCAATTG / GCTCCGCGTAATTGGAGCCCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16506 C. elegans mir-254(n4470) X. Show Description
Deletion breakpoints are: AAAATTTATTGAATTTTT / ATGAAGAATTACTATAAT...TCCAGGAGTGCAGTACGA / TCTCGAACCATGTTTTCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16696 C. elegans mir-244(n4367) I. Show Description
Deletion breakpoints are:CTCGGCAATTGGCGATATTCGGCAATT / CCGGCAACCT...AAAAATACACA / AAAAAGTGAAAATTTAAAAAAATCCACAGCA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT16762 C. elegans mir-256(n4471) V. Show Description
Complete deletion allele of mir-256 from bases 5826-6853 on T07H8. This mutation likely has a polar effect on mec-1, which starts at 6924 on T07H8 (the deletion covers putative promoter elements).
MT16848 C. elegans mir-249(n4983) X. Show Description
Deletion breakpoints are:TGCCAACTGGATTGAACAAAACAACT / TGCACACAAGAGAGAGGTCCACCTAGCAA...AGATAAGTCGTACATCACTTTAT / CTGTTTAATGGATTAGATTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT17431 C. elegans nDf49 II; nDf59 V; mir-247(n4505) X. Show Description
mir-44, mir-61, and mir-247 are members of the mir-44 family. mir-45 is also part of this family, but is not deleted in thsi strain; it is closely linked to mir-44. Reference: Curr Bio (2010) 20:367-73.
MT17676 C. elegans mir-45(n4280) II; nDf59 V; mir-247(n4505) X. Show Description
nDf59 removes mir-61 and mir-250. mir-6, mir-247, and mir-45 are related in sequence. Reference: Curr Bio (2010) 20:367-73.
MT17997 C. elegans mir-235(n4504) I. Show Description
Deletion breakpoints are: ATCGGCCATCAGAACAGTGCAAGAAAT / TTGAGAAATATG...ATCCACAGGTGGT / GTCATCTGAAGAAAGGACACACATACATA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
MT18016 C. elegans nDf63 III; mir-63(n4568) X. Show Description
Both deletions are homozygous by PCR. mir-63, mir-229, mir-64, mir-65, and mir-66 are related in sequence. nDf63 removes mir-229, mir-64, mir-65, and mir-66. nDf63 was outcrossed 6x; n4568 has been outcrossed 2x. Reference: Curr Bio (2010) doi:10.1016/j.cub.2009.12.051.
MT18023 C. elegans lin-4(e912) II; mir-237(n4296) X. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
MT18043 C. elegans mir-240&mir-786(n4541) X. Show Description
Deletion breakpoints are: TTGTTGGAGAAATGAATAAA / TGGAACAAAATTAAGAATA...AATGTTTATTATGTTGCAAG / TCTACAAAATTAGGGAACA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
VL148 C. elegans unc-119(ed3) III; wwEx23. Show Description
wwEx23 [mir-270p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VL187 C. elegans unc-119(ed3) III; wwEx20. Show Description
wwEx20 [mir-245p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VL200 C. elegans unc-119(ed3) III; wwIs3. Show Description
wwIs3 [mir-236::GFP + unc-119(+)]. Wild-type.
VL211 C. elegans unc-119(ed3) III; wwEx18. Show Description
wwEx18 [mir-227-80p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VL311 C. elegans unc-119(ed3) III; wwIs6. Show Description
wwIs6 [mir-255p::GFP + unc-119(+)]. Wild type.
VL316 C. elegans unc-119(ed3) III; wwIs4. Show Description
wwIs4 [mir-238p::GFP + unc-119(+)]. Wild type.
VL347 C. elegans unc-119(ed3) III; wwEx19. Show Description
wwEx19 [mir-230p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VL370 C. elegans unc-119(ed3) III; wwIs5. Show Description
wwIs5 [mir-240-786p::GFP + unc-119(+)]. Wild type.
VL397 C. elegans unc-119(ed3) III; wwEx31. Show Description
wwEx31 [mir-268p::GFP + unc-119(+)]. Maintain by picking WT.
VL573 C. elegans unc-119(ed3) III; wwEx21. Show Description
wwEx21 [mir-252p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VL624 C. elegans unc-119(ed3) III; wwEx33. Show Description
wwEx33 [mir-232p::GFP + unc-119(+)]. Wild type.
VL674 C. elegans unc-119(ed3) III; wwEx22. Show Description
wwEx22 [mir-269p::GFP + unc-119(+)]. Maintain by picking non-Unc.
VT1066 C. elegans nDf51 V; mir-84(n4037) X. Show Description
Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1102 C. elegans lin-28(n719) I; lin-46(ma164) nDf51 V; mir-84(n4037) X. Show Description
Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1103 C. elegans lin-28(n719) I; nDf51 V; mir-84(n4037) X. Show Description
Precocious heterochronic phenotype, omission of L2-stage program resulting in fewer seam cells by the L3 stage worms. Precocious alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1113 C. elegans unc-119(ed3) III; maIs135. Show Description
maIs135 [mir-237p::GFP + unc-119(+)]. Wild type.
VT1142 C. elegans nDf51 V; mir-84(n4037) X; ctIs39. Show Description
ctIs39 [hbl-1::GFP + rol-6(su1006)]. Rollers and GFP+. Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. >75% of animals explode at the vulva at the L4 molt. ctIs39 [hbl-1::GFP]: integrated reporter codes for 133 amino acids of HBL-1 followed by GFP, and contains 1.4 kb of hbl-1 3' UTR plus an NLS. hbl-1::GFP is elevated in the hypodermal syncytium at the L3 stage. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1143 C. elegans lin-41(ma104) I; nDf51 V; mir-84(n4037) X. Show Description
Retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells by the L3 stage and incomplete alae formation. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1145 C. elegans lin-46(ma164) nDf51 V; mir-84(n4037) X. Show Description
Strong retarded heterochronic phenotype, reiteration of L2-stage program resulting in extra seam cells and failure to generate alae. Vul. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1146 C. elegans nDf51 V; hbl-1(ve18) mir-84(n4037) X. Show Description
Weak retarded heterochronic phenotype with incomplete alae. nDf51 is a 5930 bp deletion starting 1762 bp upstream of mir-241, removing mir-241, mir-48, and F56A12.6 (snoRNA).
VT1189 C. elegans unc-119(ed3) III; maIs140. Show Description
maIs140 [mir-241p::GFP + unc-119(+)]. Wild type.
VT1470 C. elegans unc-119(ed3) III; maIs173. Show Description
maIs173 [mir-242p::GFP + unc-119(+)]. Wild type.
VT1474 C. elegans unc-119(ed3) III; maIs177. Show Description
maIs177 [mir-243p::GFP + unc-119(+)]. Wild type.
VT1477 C. elegans unc-119(ed3) III; maIs180. Show Description
maIs180 [mir-244p::GFP + unc-119(+)]. Wild type.