Search Strains

Fewer Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
DA2250 C. elegans mgl-2(tm355) I; mgl-1(tm1811) X. Show Description
Superficially wild-type; multiple subtle phenotypes related to nutritional response. References: Kang C, You YJ, Avery L. Genes Dev. 2007 Sep 1;21(17):2161-71. Kang C, Avery L. Genes Dev. 2009 Jan 1;23(1):12-7.
CHS1275 C. elegans mgl-1(yum2769) mgl-2(yum2770) mgl-3(yum2771) c30a5.10(yum2772) f35h10.10(yum2773) X. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
OH10050 C. elegans otIs317. Show Description
otIs317 [mgl-1::mCherry + pha-1(+)].
OH10545 C. elegans otIs341 X. Show Description
otIs341 [mgl-1::GFP + pha-1(+)].
OH10733 C. elegans cnd-1(ot704) III; otIs341 X. Show Description
otIs341 [mgl-1::GFP + pha-1(+)]. cnd-1(ot704) is Q118=>STOP.
OH10739 C. elegans cnd-1(ot705) III; otIs341 X. Show Description
otIs341 [mgl-1::GFP + pha-1(+)]. cnd-1(ot705) is L42=>F.
OH10953 C. elegans hlh-16(ot711) I; otIs341 X. Show Description
otIs341 [mgl-1::GFP + pha-1(+)]. hlh-16(ot711) is R21=>STOP.
OH10969 C. elegans unc-42(ot712) vsIs33 V; otIs341 X. Show Description
vsIs33 [dop-3::RFP] V. otIs341 [mgl-1::GFP + pha-1(+)] X. unc-42(ot712) is W181=>STOP.
OH11030 C. elegans otIs379 otIs317. Show Description
otIs379 [cho-1(-3006/-2642)::GFP + rol-6(su1006)]. otIs317 [mgl-1::mCherry + pha-1(+)]. otIs379 appears to be linked to otIs317. Rollers.
OH15499 C. elegans pha-1(e2123) III; otIs669 V; otEx7206. Show Description
otEx7206 [mgl-1(fosmid)::GFP + inx-6(prom18)::TagRFP + pha-1(+) + OP50(genomic DNA)]. Maintain at 25C to retain array. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). Reference: Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642 Free pre-print available at https://www.biorxiv.org/content/10.1101/676312v2
PS9192 C. elegans mgl-1(sy1623) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of mgl-1. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTGCACTTATTCTTGATTCATGCTCAAATCCAGCA right flanking sequence: TATGCGCTAAACCAGAGTTTAGATTTTGTGAGAG inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTCTGGTTTAGCGCATATGC Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
VC3196 C. elegans smgl-1(ok2423) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
F20G4.1. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2423 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: TCCAACCAATCCAGCTTTTC. External right primer: CCAAAACGAGAAGACGGAGA. Internal left primer: TTCGACTTTTTCGGCGAT. Internal right primer: ATGGAACATCCTGATGCTGA. Internal WT amplicon: 1173 bp. Deletion size: 637 bp. Deletion left flank: TTCTAAAAATAATTAAATTAGAGTGTTAAA. Deletion right flank: CGTATGGTTGCCACGTCGCGAGATCATGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
IK3237 C. elegans njIs121 II. Show Description
njIs121 [glr-1p::cz::caspase-3(p17) + mgl-1p::caspase-3(p12)::nz + ges-1p::NLS::GFP] II. Targeted ablation of RMD/D/V neuron. Reference: Ikeda M, et al. Proc Natl Acad Sci USA. 2020 Mar 2;117(11):6178–6188. PMID: 32123108.
IK3603 C. elegans njEx1559. Show Description
njEx1559 [mgl-1p::flp + glr-1p::frt::HisCl1::SL2::mCherry + ges-1p::NLS::GFP]. Pick fluorescent animals to maintain. Cell silencing of RMD/D/V neuron. Reference: Ikeda M, et al. Proc Natl Acad Sci USA. 2020 Mar 2;117(11):6178–6188. PMID: 32123108.
OH16077 C. elegans pha-1(e2123) III; otEx7419. Show Description
otEx7419 [mgl-1p::GFP + pha-1(+)]. GFP expression labels 4 of the 6 RMD neurons (RMDD and RMDV pairs, but not RMDL/R pair). Maintain at 25C to retain array.
OH16795 C. elegans otEx7677; nlp-45(ot1046) X. Show Description
otEx7677 [mgl-1p::nlp-45 cDNA::SL2::TagRFP::p10 3'UTR + inx-6(prom18)::TagRFP]. Pick RFP+ to maintain. Over-expression of nlp-45 in the RMDD/V neurons in nlp-45 mutant background. Reference: Sun H & Hobert O. Nature. 2021 Dec;600(7887):93-99. doi: 10.1038/s41586-021-04071-4. PMID: 34759317.