More Fields
Strain Species Genotype
VC857 C. elegans +/szT1 [lon-2(e678)] I; C24A8.6(gk413)/szT1 X. Show Description
C24A8.6. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and gk413 homozygotes (sick, often sterile, with body morphology defects, lots of arrested embryos). Also segregates viable gk413 hemizygotes (WT males). Phenotype of homozygote may be suspicious, as deletion appears to affect only an intron. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC858 C. elegans +/szT1 [lon-2(e678)] I; pdi-2(gk375)/szT1 X. Show Description
C07A12.4a. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and gk375 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC921 C. elegans +/szT1 [lon-2(e678)] I; tag-275(gk365)/szT1 X. Show Description
C34H3.1. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and gk365 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC963 C. elegans ppk-1(ok1411)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
F55A12.3. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, arrested szT1 aneuploids, Lon-2 males, and ok1411 homozygotes (arrest stage/phenotype undetermined). May also segregate viable ok1411 hemizygotes (WT males), but homozygous ok1411 hermaphrodites have not been recovered. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC970 C. elegans +/szT1 [lon-2(e678)] I; pdi-6(ok1373)/szT1 X. Show Description
B0403.4. Homozygous viable deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1373 homozygotes (homozygotes are slow-growing, short, Unc, Egl, starve a plate only with difficulty). Viable hemizygous ok1373 males are also segregated. Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VT3042 C. elegans nDf50 II; her-1(n695) V; nEx1187. Show Description
nEx1187 [mir-35 mir-45(genomic) + sur-5::GFP]. Pick GFP+ to maintain. Segregates GFP+ Egl animals carrying nEx1187 (mir-35 rescuing array) and GFP- animals that develop as XX pseudomales. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.
VT333 C. elegans +/szT1 [lon-2(e678)] I; dpy-17(e164) III; dpy-6(e14) lin-14(n536) maDf2/szT1 X. Show Description
Heterozygotes are Dpy and segregate Dpy, males and dead eggs.
VX300 C. elegans yfSi1 II. Show Description
yfSi1 [nspf-1p::nspf-1::6xHis::tbb-2 3' UTR + loxP, II:8420157]. C-terminal 6xHis-tagged NSPF-1 allows visualization of NSPF seminal fluid protein localization in males and hermaphrodites. Transgene inserted into ttTi5650 MosSCI site (II:8420157) using CRISPR/Cas9. Reference: Kasimatis KR, et al. (2022) No evidence of sexual conflict for a novel sperm-derived seminal fluid protein in Caenorhabditis nematodes. bioRxiv doi: https://doi.org/10.1101/2022.09.22.509081
WH170 C. elegans eff-1(oj55) II. Show Description
Loss of cell fusion in hypodermis (epithelial fusion failures). Viable and fertile as homozygotes. Tail-spike defect in all young larvae, less visible in older larvae and adults. oj55 appears to cause incomplete loss of function, as many cells fuse in postembryonic development. Homozygous males have tail and mating defects. ES-3. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain.
WH171 C. elegans eff-1(oj55) II; jcIs1 IV. Show Description
jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. Loss of cell fusion in hypodermis (epithelial fusion failures). Viable and fertile as homozygotes. Tail-spike defect in all young larvae, less visible in older larvae and adults. oj55 appears to cause incomplete loss of function, as many cells fuse in postembryonic development. Homozygous males have tail and mating defects. ES=3. Cloned: ORF C26D10.5 encodes a type-I membrane glycoprotein with a single TM domain. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Mohler WA, et al. Curr Biol. 1998 Sep 24;8(19):1087-90.
WM98 C. elegans sma-2(e502) ced-7(n1892) cdk-1(ne236)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
Heterozygotes are WT and segregate WT, Smalls which produces dead eggs, and Dpy Steriles. Throws males.
WS841 C. elegans ptp-2(op194) unc-4(e120)/mIn1 [dpy-10(e128)] II; him-5(e1490) V. Show Description
Heterozygotes are WT and segregate WT, Uncs which are sterile (>10 offspring) and Dpys. Throws males of all classes. mIn1 pka mC6.
XM1007 C. elegans fog-3(q443) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); unc-43(n498) IV. Show Description
Heterozygotes are Unc with pharyngeal GFP signal. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous unc-43(n498); fog-3(q443) animals are females.
ZM54 C. elegans hpIs3 X. Show Description
hpIs3 [unc-25p::syd-2::GFP] X. GFP is expressed in small puncta along ventral and dorsal cords; bright perinuclear staining in DD and VD cell bodies. hpIs3/+ and hpIs3 males have reduced GFP levels in cell bodies. Reference: Yeh E, et al. J Neurosci. 2005 Apr 13;25(15):3833-41.
ZT60 C. elegans csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV. Show Description
Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in this csr-1 null-mutant homozygotes. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. The deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. The inversion-based balancer in ZT60 is more amenable to producing csr-1(fj54) homozygous males than a translocation-based balancer (ZT3). Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.
ZT68 C. elegans csr-1(fj162) ?. Show Description
RNAi deficient (Rde). High incidence of males (Him). fj162 at the second K-rich region is an in-frame duplication (comprising of a small duplication and a tiny inverted duplication) generating 61 extra amino acids. The fj162 mutation can be checked by PCR with the following primers: TCGGATGTTGACTACAACGC and GAAGGTAGAAACTTCATTCCAGCAC.
ZT73 C. elegans coh-4(tm1857) coh-3(gk112)/tmC16 [unc-60(tmIs1210)] coh-3(gk112) V. Show Description
Pick wild-type Venus+ animals to maintain. coh-4(tm1857) coh-3(gk112) homozygotes exhibit defects in synaptonemal complex formation on meiotic chromosomes. Many of the progeny from coh-4 coh-3 homozygotes exhibit embryonic lethality, likely due to aneuploidy, but only a few progeny hatch and exhibit the Him phenotype. The coh-3 and coh-4 genes encode nearly identical meiosis-specific kleisins. The deletion mutations can be checked by PCR with the following primers: coh-4(tm1857): TACGCGGCACACATGGGTCT and CAATTCCCCCTAGACATACGATTC; coh-3(gk112): CTCGCAGCGATCGAGCAAGC and AACTGAACATGAGAGCCACGAAG. tmC16 homozygotes are Unc Venus(+). [NOTE: ZT73 with the inversion-based balancer is more amenable to producing coh-4 coh-3 homozygous mutant males than TY5120 with a translocation-based balancer.] Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.