Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP n5287 homozygotes (embryonic lethal). Homozygous hT2 [bli-4 let-? qIs48] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. n5287 is a 2,694 bp deletion (flanking seq 5' - TGCAACTGCCGCCATTGCTC 3' - AAAACTCTCTAGCATATTGT) and 25 bp insertion (TCTGCCATCATTGCTGCCATTGCTC). Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.

Heterozygotes are Dpy and segregate Dpy, DpyUnc and dead eggs. e1259 has a ts maternal effect.

nIs363 [D2096.6 (1.7kb UP)::pes-10::4xNLS::GFP + lin-15AB(+)]. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27 [NOTE (Aug 2019): the nIs363 trasngene in this strain was previously described as nIs363 [D2096.6 (1.7kb UP)::4xNLS-GFP] X.]

Revertant.

Use as a replacement strain for SP457. Rubberband Unc.

nIs283 [gcy-10p::4xNLS::GFP + lin-15(+)]. gcy-10p::4xNLS::GFP is expressed in I1 neurons. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15; 500(7462): 354-358.

nIs396 [sams-5 3'::4xNLS-GFP + lin-15(+)] V. GFP expression in MI. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27

nIs407 [hlh-2::GFP + lin-15(+)]. Reference: Nakano S, Ellis RE, Horvitz HR. Development. 2010 Dec;137(23):4017-27.

Heterozygotes are WT and segregate WT, Muv or Steriles (homozygous n941), Unc-36 (homozygous eT1), and dead eggs. Pick wild-type and check for correct segregation of progeny to maintain. n941 is a lin-12 null allele. lin-12(n941) homozygotes are Muv or Ste. e1467 is also carried on eT1.

nIs394 [ngn-1::GFP + lin-15(+)] III. Translational GFP reporter. Reference: Nakano S, et al. Development. 2010 Dec;137(23):4017-27.

Egl. Coiler. HSN-.

nIs408 [lin-29p::lin-29::mCherry + ttx-3p::GFP] I. Reference: Harris DT, Horvitz HR. Development. 2011 Sep;138(18):4051-62.

HSN-. Egl. Mec.

Heterozygotes are Unc and segregate Unc, DpyUnc (Dpy is ts) and dead eggs. Maintain by picking Uncs.

nIs425 [myo-2p::GFP] I. nIs175 [ceh-28p::4NLS::GFP + lin-15(+)] IV. Heterozygotes are GFP+ wild type and segregate GFP+ Unc, GFP+ wild type, and GFP- sptf-3 homozygotes. nIs425 was integrated into sptf-3(tm607)/hIn1[unc-101(sy241)] I. The position of integration appears to be close to or lie within the region covered by hIn1: sptf-3(tm607) heterozygotes are GFP+ whereas sptf-3(tm607) homozygotes do not express GFP in the pharynx. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.

nIs431 [GFP::sptf-3] X. GFP::SPTF-3 is ubiquitously expressed. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.

nIs51 [egl-10(+) + lin-15(+)] X. Egl-C, Bor, hyperforaging, hyperactive locomotion, and male longevity and mating reduced. By Western blotting and staining the EGL-10 protein is highly overexpressed relative to N2. nIs51 was generated by injecting the lin-15 rescuing plasmid pEK1 at 50 ug/ml and the egl-10 rescuing fragment pMK21 at 80 ug/ml into MT1642 lin-15(n765) worms. The resulting strain was gamma irradiated and an integrant isolated, and was backcrossed to N2 four times. nIs51 was mapped to the right arm of X.

Rubberband Unc. Reverts. There is some question regarding e1500 in this strain. Please see MT19321 as a better strain.