| MT1222 |
C. elegans |
egl-6(n592) X. Show Description
Egg laying defective. Retains late stage eggs. Males mate. Weak kinker. Semidominant.
|
|
| MT1229 |
C. elegans |
egl-12(n599) V. Show Description
Egl.
|
|
| MT1231 |
C. elegans |
egl-23(n601) IV. Show Description
Egg laying defective. Makes bags of worms. Dominant. Sluggish.
|
|
| MT1232 |
C. elegans |
egl-12(n602) V. Show Description
Egg laying defective. Retains late stage eggs. Semidominant.
|
|
| MT12352 |
C. elegans |
trr-1(n3630)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT and GFP+ and segregate WT, Dpy GFP+, and Sterile GFP-. n3630 predicted to cause W2132Amber.
|
|
| MT1236 |
C. elegans |
egl-40(n606) IV. Show Description
Egg laying defective. Retains late stage eggs. Semidominant. Temperature sensitive-non or weakly Egl at 15C. Males mate.
|
|
| MT1241 |
C. elegans |
egl-21(n611) IV. Show Description
Egg laying defective. Retains late stage eggs. Temperature sensitive-non or weak Egl at 15C.
|
|
| MT1242 |
C. elegans |
egl-4(n612) IV. Show Description
Temperature sensitive Egl. Odr-see 1998 ECWM #71.
|
|
| MT12615 |
C. elegans |
mys-1(n3681) V. Show Description
Reference: Ceol CJ, Horvitz HR. Dev Cell. 2004 Apr;6(4):563-76.
|
|
| MT12719 |
C. elegans |
lin-61(n3809) I; lin-15A(n767) X. Show Description
Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
| MT12755 |
C. elegans |
ceh-32(ok343) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc. ok343 is lethal or has a linked lethal.
|
|
| MT12833 |
C. elegans |
lin-61(n3809) I. Show Description
|
|
| MT12835 |
C. elegans |
lin-61(n3809) I; lin-56(n2728) II. Show Description
SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
| MT12836 |
C. elegans |
lin-61(n3809) I; lin-38(n751) II. Show Description
SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
| MT12839 |
C. elegans |
lin-61(n3809) I; lin-8(n2731) II. Show Description
SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
| MT12853 |
C. elegans |
her-1(hv1y101) V. Show Description
|
|
| MT12881 |
C. elegans |
lin-61(n3447) I; lin-56(n2728) II. Show Description
SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
| MT12945 |
C. elegans |
mir-52(n4100) IV. Show Description
Deletion breakpoints are: CTACTCCTACAACTACAACTAC / TACTACTACTATA...ATCACGTTTAAATCA / ATTTCCCAAGAGTTTTCGTATAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12954 |
C. elegans |
mir-1(n4101) I. Show Description
Deletion breakpoints are:TAGAGCATGTTGCCAATATTGGCAT / GAAAATATTGGCAA...TCACTTTGAATATAGCG / TAGATATAGAGTAGAATTGAATCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12955 |
C. elegans |
mir-1(n4102) I. Show Description
Deletion breakpoints are:CGTCAGAAGGGCGCCTTTTCCTTCG / CCTTGCCGCATCG...CGTCATTGCCGTC / TTAACAGGCATCGAATGGAAAAATTGGCG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12958 |
C. elegans |
mir-87(n4104) V. Show Description
Deletion breakpoints are:CACACACACACACACATACATA / CATACATACAT...CACACAGCCAAAA / GGGGCGGGACGACGACTCCTCCCCGCCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12960 |
C. elegans |
epc-1(n4076) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Uncs, Ste/Mel, and dead eggs. The epc-1(n4076) deletion removes 886 nucleotides from the epc-1 locus (Y111B2A.11). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 2014 and ends at about nt. 2899 to give the junction sequence CTTCTCTGT/CCGGCTTTA.
|
|
| MT12963 |
C. elegans |
ssl-1(n4077) III/eT1 (III;V). Show Description
Heterozygotes are WT and segregate WT, Unc, Ste/Mel, and dead eggs. ssl-1(n4077) deletion removes 683 nucleotides from the ssl-1 locus (Y111B2A.23). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 5075 and ends at about nt. 5757 to give the junction sequence GATATACAC/AGACCTAAT.
|
|
| MT12969 |
C. elegans |
mir-259(n4106) V. Show Description
Deletion breakpoints are: GATTATAATGCAAACAACCTGGGGGATC / CAGTATCTTCA...AAGAGCGAAAGT / ACAGTCTCCTCCTTCTTTGCTCACTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12979 |
C. elegans |
mir-70(n4110) V. Show Description
Deletion breakpoints are:TTTTTTACCGTTGAGTTTCAGAAGT / ATATTTTTTCT...ACGACGTATTA / CATTTCTTCATAAGTGTTATTCGTCGAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12983 |
C. elegans |
mir-238(n4112) III. Show Description
Deletion breakpoints are: ACAACTTAATATCTTTTCTGGTCATTTTCAA / TACTTACCTCA...AGGTGACAGAAA / GTTGTGTGAAAATGACAAATATCTCTTTTCT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12989 |
C. elegans |
mir-53(n4113) IV. Show Description
Deletion breakpoints are: ACTCTATGATGTCCTTCAAAACAACA / TAATTTACGCCAT...CAGAATCGGGAGAAA / TTTATAATAATAGAGAGAGAGAGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12990 |
C. elegans |
mir-52(n4114) IV. Show Description
Deletion breakpoints are: CTTACCCCCCAAACCCTG / CCGCTACTACTACTACTCCTA...GAAAGGGTAGCCGGTTATT / GAAGTTGGGTCTTTTTTGGG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12993 |
C. elegans |
mir-71(n4115) I. Show Description
Deletion breakpoints are: CGATCCCGACGGCGAAAAACAG / AATAGTGATACGAC...TGTGTGTGAGCTA / GTTTCAACACTGAGGTTTTGTTGGAAAGT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT12999 |
C. elegans |
mir-85(n4117) II. Show Description
Deletion breakpoints are:TCATCTGATGACTTATCTTCA / TACTCGTGT...AACGTGATGAA / GGTCCGGATAGGGCTTGAGCTATTCGTT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13015 |
C. elegans |
mir-72(n4130) II. Show Description
Deletion breakpoints are: CTCTCTGCGGAATTATATCAATTTTCT / ACCAATTCTATA...CAGGTCGAGCACTC / GGACTCCTTCTGTGAAGTGCACCTG. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13016 |
C. elegans |
nDf52 III. Show Description
nDf52 removes mir-229 and mir-64. Deletion is 652 bp from -525 to 128 from 5'end of mir-64. Reference: PLos Genet (2007) 3(12):e215.
|
|
| MT13032 |
C. elegans |
sli-1(n3538) X. Show Description
SynMuv.
|
|
| MT1306 |
C. elegans |
lin-17(n671) I. Show Description
Slightly Unc. Long irregularly shaped tail. May be Egl. Many hermaphrodites (50%) have single small protrusion posterior to vulva, some gonadal abnormality and sterility.
|
|
| MT1307 |
C. elegans |
lin-11(n672) I. Show Description
Semi-dominant Vul. Never mates.
|
|
| MT13078 |
C. elegans |
mir-73&mir-74(nDf47) X. Show Description
Deletion breakpoints are: GAGAGTCCCACACACGACTGGACTTCCA / TATCGAGCCA...AATGGCAGTCTA / CACGTTTTTCAACCAAATGCTATGGCC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13113 |
C. elegans |
tdc-1(n3419) II. Show Description
n3419 is a deletion in L-aromatic amino acid decarboxylase with homology to histadine decarboxylase. Forages while backing. PKA adc-1.
|
|
| MT13172 |
C. elegans |
mys-1(n4075) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT and GFP+ and segregate Ste GFP- and dead eggs. The myo-1(n4075) deletion removes 1010 nucleotides from the mys-1 locus (VC5.4). Relative to the first nucleotide of the predicted initiator ATG, the deletion begins at about nt. 106 and ends at about nt. 1115 to give the junction sequence GATGCCGGT/TCTGCGTGGG.
|
|
| MT13231 |
C. elegans |
nDf48 II. Show Description
Reference: Alvarez-Saavedra E, Horvitz HR. (2010) Curr Biol. 20(4):367-73.
|
|
| MT13232 |
C. elegans |
lin-65(n3441) I. Show Description
|
|
| MT1329 |
C. elegans |
lin-12(n302) III; him-5(e1467) V. Show Description
Vulvaless. Segregates males which mate well.
|
|
| MT13292 |
C. elegans |
mir-124(n4255) IV. Show Description
Deletion breakpoints are:GTCGCTCATTGATTCACATCCATTTTGAG / AAGGATGGTT...GAATGCCACGTG / GCCATGATGGGGCTCCCATTGAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT13293 |
C. elegans |
met-2(n4256) III. Show Description
Deletion of R05D3.11.
|
|
| MT1337 |
C. elegans |
lin-12(n137) III; nT1 (IV;V). Show Description
|
|
| MT13372 |
C. elegans |
nDf49 II. Show Description
mir-42, mir43 and mir-44 are deleted in nDf49. Deletion breakpoints are:GGAGCTTGCACTTCCAAAAC / CCGACGATCTGAGAAATCC...GCTATGTATCAATCTACG / CGATAGCTAGAAAAAAAT. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1338 |
C. elegans |
lin-31(n301) II; nT1 (IV;V). Show Description
|
|
| MT13406 |
C. elegans |
mir-34(n4276) X. Show Description
Deletion breakpoints are: AACAACAACAAAAACTTTTTTTACC / ATTTAAAAAAATAA...GAATGGGAAAAAAAA / GGAAGCTGTGGCCTGTCGCATAGTTAC. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1341 |
C. elegans |
lin-12(n302) III; nT1 (IV;V). Show Description
Vulvaless.
|
|
| MT13433 |
C. elegans |
mir-45(n4280) II. Show Description
Deletion breakpoints are:TCCACCAGCAAAAAGCCGT / CTCCAAAGAAGGCTGCTCCG...AAAAAACTACAAATTCTCG / TTTCCATTACTTTTCAGAAA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MT1344 |
C. elegans |
bli-3(e767) lin-17(n677) I. Show Description
|
|