More Fields
Strain Species Genotype
NK2581 C. elegans gpn-1(qy35[gpn-1::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2582 C. elegans lon-2(qy55[lon-2::mNG+loxP]) X. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2583 C. elegans unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2590 C. elegans gon-1(qy45[gon-1::mNG+loxP]) IV. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2604 C. elegans emb-9 (qy89[emb-9::mEos2+loxP]) III. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
NK2643 C. elegans lin-35(n745) I; unc-52(qy80[mNG+loxP (synthetic exon)::unc-52]) II. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous unc-52 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2644 C. elegans lin-35(n745) I; fbl-1(qy62[mNG+loxP::fbl-1]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous fbl-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2645 C. elegans lin-35(n745) I; him-4(qy33[him-4::mNG+loxP]) X. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous him-4 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2920 C. elegans emb-9(qy83[emb-9::mRuby2 + LoxP]) III; gon-1(qy45[gon-1::mNG+LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus and mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2922 C. elegans lin-35(n745) I; gon-1(qy45[gon-1::mNG+loxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
NK2987 C. elegans let-60(qy220[mNG::let-60 + LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen tag into endogneous let-60 locus. Fairly high penetrance of L1 rod-like lethality. Reference: Jayadev et al. 2023. Post-embryonic endogenous expression and localization of LET-60/Ras in C. elegans. microPublication Biology. 10.17912/micropub.biology.000931.
NM5176 C. elegans jsTi1490 IV. Show Description
jsTi1490 [LoxP::mex-5p::FLP::SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsTi1490 is an RMCE landing site inserted using miniMos located on Chr IV at 7,310,985 (at 3.32 m.u.) between glr-4 and F42C5.8. Insertion site gtacataaattataccaaatattgaTAaaagctacgaaaattccactgatat with rpl-28 transcription towards F42C5.8. Reference: Nonet ML. Genetics. 2020.
NM5178 C. elegans jsTi1492 II. Show Description
jsTi1492 [LoxP::mex-5p::FLP::SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] II. jsTi1492 is prone to silencing; pick animals with GFP+ germlines to maintain. jsTi1492 is an RMCE landing site inserted using miniMos located on Chr II at at 3,160,571 (WB273 genome; -8.14 m.u.) inserted in a repeat region between sri-34 and fbxc-55. Insertsion site ttttttgcaaaaaagtgcagtcataTAtgtatgtaaaaaattaattgaagac with rpl-28 transcription toward sri-34. Insertion site is ambiguous but likely near the edge of sri-34 side of the repeat region. Reference: Nonet ML. Genetics. 2020.
NM5179 C. elegans jsTi1493 IV. Show Description
jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsTi1493 is an RMCE landing site inserted using miniMos located on Chr IV at 9,197,338 (at 4.11 m.u.) inserted between C46C2.7 and wnk-1. Insertion site gttcgcaaaccgtctgcgtctctTAttctcttgcaattccgcgcacacac with rpl-28 transcription toward C46C2.7. Reference: Nonet ML. Genetics. 2020.
NM5233 C. elegans jsTi1453 jsSi1518 I; jsTi1493 jsSi1515 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1518 [LoxP::UAS 11X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1515 [LoxP::mec-4p::GAL4-QF::FRT3] IV. RMCE derived single copy UAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p GAL-4-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
NM5274 C. elegans jsTi1453 jsSi1527 I; jsTi1493 jsSi1549 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1527 [LoxP::lexO 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1549 [LoxP::mec-4p::lexA-L-QF::FRT-3] IV. RMCE derived single copy lexO GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p lexA-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
NM5275 C. elegans jsTi1453 jsSi1517 I; jsTi1493 jsSi1551 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1551 [LoxP::mec-4p::QF::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
NM5276 C. elegans jsTi1453 jsSi1543 I; jsTi1493 jsSi1548 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1543 [LoxP::tetO 7X::(delta)mec-7p::(delta)mec-7p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1548 [LoxP::mec-4p::rtetR-L-QF::FRT3] IV. RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet ON mec-4p rtetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
NM5312 C. elegans jsTi1453 jsSi1517 I; jsTi1493 jsSi1554 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1554 [LoxP::mec-4p::QF2::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF2 driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
NM5317 C. elegans jsTi1453 jsSi1519 I; jsTi1493 jsSi1560 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1519 [LoxP::tetO 7X:: (delta)pes10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSI1560 [LoxP::mec-4p::tetR-L-QF::FRT3] IV.RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet OFF mec-4p tetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
NM5738 C. elegans jsSi1815 V. Show Description
jsSi1815 [loxP::mex-5p::FLP::sl2::mNeonGreen + rpl-28p::FRT::GFP::his-58 3' FRT3] V. Single component RMCE landing site on Chromosome V adjacent to oxTi365. Created using CRISPR/cas9 with SEC selection and heat shock excision. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
OD2653 C. elegans ltSi1112 I; unc-119(ed3) III. Show Description
ltSi1112 [cyb-1p::cyb-1::mNeongreen::cyb-1 3'UTR + Cbr-unc-119(+)] I. CYB-1::mNG reporter using its own promoter and UTR. Single-copy transgene insertion in Chromosome I using MosSCI. Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
OD2906 C. elegans mdf-1(lt39[mNG::tev::loxP::3xFlag::mdf-1]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous mdf-1 locus using CRISPR/Cas9 engineering. gRNA sequence: tgattgcattaaacatatt Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
OD3913 C. elegans cyb-1(lt125[cyb-1::LAP::mNG::loxP::3xFlag]) IV. Show Description
mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD4087 C. elegans cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD5096 C. elegans ify-1(lt212[mNG::ify-1]) II. Show Description
mNeonGreen tag inserted at 5' end of endogenous ify-1 locus using CRISPR/Cas9 engineering. gRNA sequence: catactcgcacaagtcaaaA
OD5149 C. elegans ltSi1668 I; unc-119(ed3) III. Show Description
ltSi1668 [cyb-3p::mNeonGreen::cyb-3(re-encoded)::cyb-3 3'UTR + Cbr-unc-119(+)] I. CYB-3::mNG reporter using its own promoter and UTR; cyb-3 was re-encoded to confer resistance to dsRNA targeting endogenous cyb-3.
OH13988 C. elegans ieSi57 II; unc-3(ot837[unc-3::mNeonGreen::AID]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. The endogenous unc-3 locus is tagged with mNeonGreen and AID degron. mNeonGreen expression is seen in the cholinergic motor neurons, command interneurons, and ASI. Reference: Patel T & Hobert O. eLife 2017.
OH14070 C. elegans bnc-1(ot845[bnc-1::mNeonGreen::AID]) V. Show Description
bnc-1 was modified by CRISPR/Cas9 to create both a GFP-tagged reporter and conditional allele using the auxin-inducible degron (AID). Reference: Kerk SY, et al. Neuron 2017 (in press).
OH14125 C. elegans daf-16(ot853[daf-16::linker::mNeonGreen::3xFlag::AID]) I. Show Description
mNeonGreen tag inserted into endogenous daf-16 locus; AID at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580
OH14486 C. elegans gcy-5(ot835[gcy-5::SL2::mNeonGreen]) II; otTi6 X. Show Description
ot835 [gcy-5::SL2::mNeonGreen] III. otTi6 [hsp16-41p::che-1::2xFLAG] X. otTi6 is a miniMOS insertion of heatshock inducible che-1. Under normal growth conditions, very dim expression of gcy-5 is observed in the ASER and RIGL/R neurons. Upon heatshock, induction of CHE-1 leads to ectopic expression of gcy-5 (ectopic expression varies depending upon age at heatshock and genetic background).
OH14654 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; daf-2(e1370) III. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva et al., submitted
OH14897 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; ieSi60 II; daf-2(e1370) III. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR] II. Temperature sensitive dauer constitutive. Maintain at 15C. Pharyngeal muscle-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OH14945 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID]) I; ieSi61 II; daf-2(e1370) III. Show Description
ieSi61[ges-1p::TIR1::mRuby + unc-119(+)] II. Temperature sensitive dauer constitutive. Maintain at 15C. Intestine-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted
OH15227 C. elegans unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID]) III. Show Description
unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press).
OH15439 C. elegans ceh-34(ot903[ceh-34::mNG::3xFLAG::AID]) V. Show Description
CRISPR/Cas9-engineered insertion of mNeonGreen::3xFLAG::AID tags into endogenous ceh-34 locus. Reference: The enteric nervous system of C. elegans is specified by the Sine Oculis-like homeobox gene ceh-34. Vidal B, et al. bioRxiv 2021.11.30.470650; doi: https://doi.org/10.1101/2021.11.30.470650
OH18012 C. elegans pha-1(e2123) III; otEx7948. Show Description
otEx7948 [lgc-8p::mNeonGreen::PH::p10 + pha-1(+)]. I1 neurons are labeled with mNeonGreen. Can be used to isolate I1 neurons by FACS (green-only). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).
PHX1805 C. elegans ser-1(syb1805[ser-1::T2A::mNeonGreen]) X. Show Description
Endogenous ser-1 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Derived in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
PHX1841 C elegans mod-1(syb1841[mod-1::T2A::mNeonGreen]) V. Show Description
Endogenous mod-1 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
PHX1866 C. elegans ser-4(syb1866[ser-4::T2A::mNeonGreen]) III. Show Description
Endogenous ser-4 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
PHX1867 C elegans ser-5(syb1867[ser-5::T2A::mNeonGreen]) I. Show Description
Endogenous ser-5 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
PHX1941 C elegans ser-7(syb1941[ser-7::T2A::mNeonGreen]) X. Show Description
Endogenous ser-7 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.
PHX3293 C. elegans bli-2(syb3293[bli-2::mNG]) II. Show Description
mNeonGreen tag inserted at C-terminus of endogenous bli-2 locus. Superficially wild-type with green fluorescence in L4 epidermis and adult stage cuticle. Reference: Adams JRG, et al. Nat Commun. 2023 Nov 18;14(1):7506. doi: 10.1038/s41467-023-43058-9. PMID: 37980413.
PHX3685 C. elegans dpy-17(syb3685[dpy-17::mNG]) III. Show Description
mNeonGreen tag inserted at C-terminus of endogenous dpy-17 locus. GGATACAGAAACTAA -> GGATACAGAAAC^TAA. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
PHX3691 C. elegans sqt-3(syb3691[sqt-3::mNG(int)]) V. Show Description
mNeonGreen tag inserted into endogenous sqt-3 locus between CFCS and collagen domains. GCCTACGGAGGACCAGAAGTCAACC -> GCCTACGGAGGA^CCAGAAGTCAACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
PT3406 C elegans nekl-4(my51[nekl-4::mNeonGreen]) III; him-5(e1490) V. Show Description
mNeonGreen tag inserted into endogenous nekl-4 locus by CRISPR/Cas9 engineering. Very faint mNeonGreen expression in the dendrites, soma, and axons of all ciliated neurons. Reference: Power KM, et al. PLoS Genet. 2020 Oct 16;16(10):e1009052. PMID: 33064774
RP3498 C elegans trEx1001. Show Description
trEx1001 [idpb-3p::idpb-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.
RP3513 C elegans trEx1006. Show Description
trEx1006 [fipr-4p::fipr-4::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.
RP3515 C elegans trEx1008. Show Description
trEx1008 [idpa-3p::idpa-3::mNeonGreen + myo-2p::mCherry]. Pick animals with mCherry+ pharynx to maintain. Generated in N2 background. Reference: Kamal M, et al. bioRxiv 2022.03.11.483951; doi: https://doi.org/10.1101/2022.03.11.483951.
SBW115 C. elegans lem-2(sbw5[lem-2::mNeonGreen]) II. Show Description
mNeonGreen tag inserted at C-terminus of endogenous lem-2 locus using self-exising drug selection casette method (described by Hastie et al., 2019 J Microbiol Biol Educ). Reference: Barger SR, et al. J Cell Sci 1 November 2023; 136 (21): jcs261385. doi: https://doi.org/10.1242/jcs.261385. PMID: 37795681.