mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.

mIs14 [myo-2::GFP + pes-10::GFP]. Homozygous lethal double mutant balanced by GFP- and dpy-10-marked inversion. Pick wild-type GFP+ to maintain. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP homozygous vab-1 ptp-1 double mutants. vab-1 ptp-1 double mutants (non-GFP) are embryonic lethal. Reference: Harrington RJ, et al. Development. 2002 May;129(9):2141-53.

Heterozygotes are WT with pharyngeal GFP. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and few GFP- dsh-2(or302) mig-5(tm2639) homozygotes (Sys). Pick WT GFP+ animals and check for correct segregation of progeny to maintain.

Heterozygotes are WT with pharyngeal GFP. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and few GFP- dsh-2(or302) dsh-1(ok1445) homozygotes (Sys Unc). Pick WT GFP+ animals and check for correct segregation of progeny to maintain.

T05C12.6, T05C12.7. Heterozygotes are WT and GFP+ in the pharynx. mIn1[mIs14 dpy-10(e128)] homozygotes are Dpy and GFP+ in the pharynx. Homozygous mig-5&cct-1(ok280) worms arrest at about L2/L3. Strong loss of function for cct-1 and weak for mig-5. mig-5 is a dishelved homologue. External left primer: CGGCCTAAACGTTGATTGTT. External right primer: CAGAGTGAGTCGTGAACCGA. Internal left primer: TAATCCTGAATCCGGACGAG. Internal right primer: TACGAGATTTCGGTCCCTTG. Internal WT amplicon: 3284 bp. Deletion size: 987 bp. Deletion left flank: GCTGCAGTCTGATGTGCATGGCGGCTCCAT. Deletion right flank: TTGGTGTTGTCTATGCTTCAAGAAAATTGA. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Pick wild-type GFP+ to maintain. q725 heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP+ q725 heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP puf-8(q725) II; lip-1(zh15) IV double homozygotes. Homozygous puf-8(q725) II; lip-1(zh15) IV double mutants are ~100% Mog at 20C and ~100% Tumerous at 25C. Reference: Morgan CT, et al. Nat Chem Biol. 2010 Feb;6(2):102-4.

Homozygous Emb deletion chromosome balanced by GFP and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP nDf50 nDf49 homozygotes (arrest as late embryos). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Curr Bio (2010) 20:367-73.

Heterozygotes (wrn-1/mIn1;exo-1) are WT and GFP+. mIn1 homozygotes (mIn1;exo-1) are Dpy and GFP+. wrn-1;exo-1 homozygotes are non-GFP.  Reference: Ryu, J.S. and Koo, H.S. (2017). FEBS Lett.

F07H5.2, K08F8.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok331 homozygotes (grotty sterile Dpy with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGAAAATTGGGAGTTCGGAG. External right primer: ACCACTTGTTCCTTGCCAAC. Internal left primer: GGACTGGAAACTCCAAGCAG. Internal right primer: GACTGATGAGCCGGTATGGT. Internal WT amplicon: 2637 bp. Deletion size: 1456 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22B5.1, F22B5.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1819 homozygotes (sterile adult, often with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATGAACGCTTTTGCAGAC. External right primer: TGAGAACGGTTGTGCTCTTG. Internal left primer: TACCAATTGGACGAGGAAGC. Internal right primer: TTCTTGATGTCCGTGCTGAG. Internal WT amplicon: 2108 bp. Deletion size: 757 bp. Deletion left flank: TGCTTTAATTTGGGTGGTAGATTCGTCAGA. Deletion right flank: AACGGTAAGACCAAGGAAGACAGTGACAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK20.3, ZK20.4. Homozygous lethal/sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1910 homozygotes (late larval arrest or sterile adult with no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGACTTGCATCGTCTCCAA. External right primer: AGAGCCTTCTCAACTGCGAC. Internal left primer: TGACAGGATTCTGGCCTTTT. Internal right primer: AGAAGATTTTTATGGGCGGC. Internal WT amplicon: 2172 bp. Deletion size: 1030 bp. Deletion left flank: AAATTTCTCACTTCGTAGCATCCAAATCTG. Deletion right flank: AATCTGGTTCTTGGTCAGCAGCATCATCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T24H10.6, T24H10.3. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1931 homozygotes (Sma, Unc, Gro with tail and vulval defects). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGGCGATTATGGAAGAGGAG. External right primer: ATTGCGATGAGAAAGCTCGT. Internal left primer: ATTCTCGCAAAGGCGACTAA. Internal right primer: CAAGCGTAAGGCTGAGAAGG. Internal WT amplicon: 2301 bp. Deletion size: 1608 bp. Deletion left flank: AGTTAGTAGGAACCAAGTTTGGCGAATACG. Deletion right flank: AAAACTTATAAATAAAGTGACAGATTTTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

D2089.1, D2089.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2079 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAATTACGTCGCCGGTTTA. External right primer: CACTGTTTTTCGGAGCCAAT. Internal left primer: ACATTTCGACATCGGCTACC. Internal right primer: CACCTCAACTTATTCGGGGA. Internal WT amplicon: 3201 bp. Deletion size: 1429 bp. Deletion left flank: TAAGCCATTTCTCGAAGAAAACAAAGCACA. Deletion right flank: AGATCCAAAGATCGAAAGCGTGACAAGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1127.5, ZK1127.12. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2279 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATATGTTGCAAAGGACCGC. External right primer: CTCAGCACCTTCCAATCCTC. Internal left primer: TGAATTCTCACAATGGAGCG. Internal right primer: AAATCTGAGCCGGTCCTGTA. Internal WT amplicon: 3074 bp. Deletion size: 1999 bp. Deletion left flank: TTTAGTTTCTATTTGAGCTCAATCCTCAAA. Deletion right flank: ATCTACGGTAACAGTGTCCGATCTACGGTA. Insertion Sequence: GGAAGTGTGAAACATCTTTAGGACAGAGTGTCATAAATGTGCTTGCAAGTATTTGAGCA CTACTGTCAAGGGCACCTCCCATGTAAATTTGTTGAAGAAGAGCATGACCGGCTTCAAT TCCAATGTCTTCTGGAAGAATTGGAACTCCTGATTCGCCCTTCGGTCTTGAAATAGCTT CTGCTTGGTAGATAACACCCTCTGTCGTTTCGGCGGTTAAGAACAGACCATATCCTGGA GAAGCGCCACCAGCATCACCTTTCCGTTGATCAACAGTAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F18C5.2. Homozygous lethal deletion chromosome linked to dpy-10 mutation, balanced by GFP- and dpy-10-marked inversion. Heterozygotes are Dpy with relatively dim GFP expression in pharynx, and segregates Dpy dim GFP, Dpy bright GFP (mIn1 homozygotes) and gk116 homozygotes (embryonic/early larval arrest). Nature of dpy-10 lesion unknown; recessive lethality could be the result of this mutation. Pick Dpy dim GFP+ and check for correct segregation of progeny to maintain." Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F22B5.10, F22B5.9. fars-3 is the new name for frs-2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1029 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTGTTGTTCCACCCACAAGA. External right primer: TGCCGTTTTCTGCTCTTTTT. Internal left primer: CAGCCAGATGCACTTTCTCA. Internal right primer: CATTTGGGAGTTTGGTGGAG. Internal WT amplicon: 1427 bp. Deletion size: 823 bp. Deletion left flank: TGCAGTTCATATTGGAAATCCAAAAACTCT. Deletion right flank: TATCACATGGCTTCTTGTGTATAGATCCGA. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

T28D9.10, T28D9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2084 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGTTCCGCAAAGTGCATAAT. External right primer: CTAGGAAGAGCGCGAACAAC. Internal left primer: GTTGACTCGGAAAGCCGTAA. Internal right primer: AGGAAGCGGTGTCCTACTCA. Internal WT amplicon: 3125 bp. Deletion size: 1493 bp. Deletion left flank: AGTATAGGACGTTCGATACTCAAATTTGCT. Deletion right flank: CGTGATCGCAAACGTTCTCGCAGATCCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

E02H1.5, E02H1.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2819 homozygotes (late larval arrest or sterile with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGACGTCGGTTTATGCAGC. External right primer: CCATGGTGTGCTCATTTTTG. Internal left primer: CCGGCATTCAAGTCAAATCT. Internal right primer: GGCAAGTTCGCAGATTCTTT. Internal WT amplicon: 2609 bp. Deletion size: 1622 bp. Deletion left flank: ACAATAATTAACCAAATTCCAGACGATAAT. Deletion right flank: CATTTCAGATCGTTTGGACAGTGATGAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C14A4.1, C14A4.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT relatively dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk347 homozygotes (L4 to young adult arrest, often bursts at gonadal placque or vulva). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

ZK1248.13, ZK1248.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1096 homozygotes (embryonic or early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes are WT with relatively dim pharyngeal GFP signal. Segregates Dpy with bright GFP (mIn1 homozygotes). Segregates very few escapers that are non-GFP (ok1021 tm2214 homozygotes).

Maintain by mating GFP+ females with GFP+ males.

WT gross phenotype, with GFP semi-dominantly expressed in 4-60 cell embyros, pharyngeal muscle and gut. Segregates WT, brighter Dpy GFP mIn1 homozygotes and non-GFP bli-2 unc-4 homozygotes. Pharyngeal and gut GFP is easily seen in a UV dissecting microscope; early embryonic signal requires higher magnification. mIs14 occasionally crosses off mIn1[dpy-10], apparently by double recombination. Pick WT, check for GFP and check for correct segregation of progeny to maintain. mIs14 is ccEx9747 integrated into mIn1[dpy-10]. This is a three-construct element containing myo-2 and pes-10 promoters and a gut enhancer fused individually to GFP coding sequence.

mIs14 [myo-2p::GFP + pes-10p::GFP]. Him. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and Egl non-GFP ez25 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.

Heterozygotes are WT and GFP+ in the pharynx. mIn1[dpy-10(e128) mIs14] homozygotes are Dpy and GFP+ in the pharynx. Homozygous fkh-6(ez16) hermaphrodites are sterile and have gonadogenesis defects. Homozygous fkh-6(ez16) males are sterile and strong Gon, "white patch" phenotype. 25% of males have a hermaphrodite vulval structure.

Heterozygotes are WT and GFP+. mIn1 homozygotes are Dpy and GFP+. vab-1; sax-3 homozygotes are synthetic lethal.

Heterozygotes are non-Dpy with a green pharynx and a WT germ line. fbf-1 fbf-2 homozygotes are non-Dpy, GFP-, and have small germ lines containing only sperm. mIn1[mIs14 dpy-10(e128)] homozygotes are Dpy, GFP+ and have a WT germ line. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT and GFP+. mIn1 homozygotes are Dpy and GFP+. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT with major GFP signal in pharynx. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and GFP- gld-3 homozygotes. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- DpyUncs.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with GFP+ pharynx, and segregate Dpy GFP+ mIn1 homozygotes, and GFP- low viability non-Egl hermaphrodites. Viability of first generation nDf50 homozygotes (GFP-) segregated from balanced heterozygotes is rescued by maternal contribution of mir-35-41 from balancer. Second generation GFP- animals are low viability. Reference: McJunkin K, Ambros V. Genes Dev. 2017 Feb 15;31(4):422-437.

Heterozygotes are WT with pharyngeal GFP. Segregates WT GFP+, Dpy GFP+ (mIn1 homozygotes) and non-GFP triple homozygotes (mostly Emb with a few animals surviving to early L1). Pick WT GFP+ animals and check for correct segregation of progeny to maintain.

Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- Uncs which are viable but lay oocytes (lay viable embryos if mated to WT males). Strain has a Him phenotype. 3.4% males. Mutant males have abnormal sperm. Class 1 suppressor.

Heterozygotes are WT with major GFP signal in pharynx. Segregates Dpy GFP+ mIn1 homozygotes and GFP- Uncs which are viable but lay inviable embryos (lay viable embyros if mated to WT males). Strain has a Him phenotype. 0.4% males. Mutant males are fertile. Class 2 suppressor.

ZK177.6, ZK177.5. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- hDf35 unc-4 homozygotes (larval/sterile adult arrest). Pick fertile GFP WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Heterozygotes are superficially WT (DTC migration defects) with relatively dim pharyngeal GFP signal, and segregate superficially WT (DTC migration defects) with dim GFP, Dpy with bright GFP (mIn1 homozygotes), and non-GFP gk388 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.

Maintain by mating GFP+ females with GFP+ males.

T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk463 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

C06A8.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk465 homozygotes (larval arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTGCAATCGGAGTGGTTTC. External right primer: GGGAATCATGCCAATTATGG. Internal left primer: GGTCATGAAGCATTCGAGGT. Internal right primer: GAACAGAGCGTTGCATTGAA. Internal WT PCR product: 718. Deletion size: 141 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

qIs24 [lag-2p::GFP]. Maintain by picking individual animals with green DTCs and green pharynx and scoring offspring for Fems and Fbfs. fem-3 is not well balanced by qIs24. fbf-1 fbf-2 homozygotes are germline proliferation defective and make only sperm. fem-3 homozygotes make only oocytes. fbf-1 fbf-3; fem-3 proliferates more than fbf-1 fbf-2 and makes only oocytes; also Muv. qIs24 contains lag-2::GFP; Distal Tip Cells are green; homozygotes are Rollers and heterozygotes Roll weakly. mIn1 is Dpy and GFP+ in the pharynx. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

To maintain, check individual fertile worms for both Sep and Fog offspring. sep-1 homozygotes are sterile at 20C and 25C (Sterile and Unc at 25C), and mostly normal at 15C. fog-1; fbf-1 fbf-2 homozygotes have small germ lines and are often Muv. Best to maintain at 25C for scoring. Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

F10E7.2, F10E7.4, F10E7.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and Unc non-GFP gk460 homozygotes (probable embryonic arrest; bli-2 not evident until adult stage). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AACAATGTTTGGTCCATCCC. External right primer: ACACCAGGTTGACCTCCTTG. Internal left primer: ATGAGCCCAAATGAACCAAC. Internal right primer: AATAGGCACAATACGCCTGC. Internal WT PCR product: 5051. Deletion size: 4507 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270

q1023 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5935 fbf-2(q945[3xFLAG::fbf-2]) II. Pick GFP+ t maintain. Homozygous sterile (Mog) mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok91 q1023 homozygotes (sterile Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes. fbf-1(q1227) fbf-2(q945[3xFLAG::fbf-2]) homozygotes are partially sterile, ~50% make excess sperm and delay oogenesis resulting in delayed egg laying when compared to wild-type animals. Pick WT dim GFP and check for correct segregation of progeny to maintain. q1227 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5810.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1011 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2 derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. q1228 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5984.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1250 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK3101.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1251 is an engineered H324A point mutation in FBF-1 derived by modification of parental strain JK3101.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H326A, Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.