More Fields
Strain Species Genotype
VC1458 C. elegans dyrb-1&dnj-23(ok1931)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T24H10.6, T24H10.3. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1931 homozygotes (Sma, Unc, Gro with tail and vulval defects). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGGCGATTATGGAAGAGGAG. External right primer: ATTGCGATGAGAAAGCTCGT. Internal left primer: ATTCTCGCAAAGGCGACTAA. Internal right primer: CAAGCGTAAGGCTGAGAAGG. Internal WT amplicon: 2301 bp. Deletion size: 1608 bp. Deletion left flank: AGTTAGTAGGAACCAAGTTTGGCGAATACG. Deletion right flank: AAAACTTATAAATAAAGTGACAGATTTTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1474 C. elegans K12D12.1(ok1930)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
K12D12.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1930 homozygotes (sterile Unc with withered tail, often grotty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCAATCAAAGGATTCGAGG. External right primer: ATGTCCTGGCCTTCCTTTTT. Internal left primer: GAACCCCTCAAGATCGCATA. Internal right primer: GGCTCCTTTGGCTCTTTCTT. Internal WT amplicon: 3358 bp. Deletion size: 1788 bp. Deletion left flank: TAGTGACGCTGGAGAAAGTTTTTATCCAGT. Deletion right flank: AGCTCCATGGTACAAGAACTTCCGCGGAAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1498 C. elegans cap-2(ok1929)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
M106.5. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes) and non-GFP ok1929 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTTGTTCTTTTTGCACGCTG. External right primer: AGGGAACTGATGTTCCGATG. Internal left primer: CGGGAGCCAATTTACAGAAA. Internal right primer: GAACGAAAATGGTCCAGGAA. Internal WT amplicon: 2129 bp. Deletion size: 1084 bp. Deletion left flank: AAAACAAAAATTTGAAGAACTCTGGCGAAA. Deletion right flank: CTGCAGACAAACAAAAGCTCCAGCGGTGTG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1505 C. elegans npp-3(ok1999)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
K12D12.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1999 homozygotes (early- to mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTTGCCAGTGTCAATCAGC. External right primer: TCGCTCTCCACTTCTCCAGT. Internal left primer: CCCCAGAACCACAAGACACT. Internal right primer: TCGATGCTTGATTTGCTGAC. Internal WT amplicon: 3383 bp. Deletion size: 1321 bp. Deletion left flank: GTAACCAACAATCATACGACGAACAGCGAA. Deletion right flank: ATTCGATATATTTGAGGCCTGAAACTCACG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1506 C. elegans gpb-1(ok1875)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F13D12.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1875 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTGATGTGGGGGTTTTAGGA. External right primer: ATCGCGTCGCTCACTAGAAT. Internal left primer: ATCGGGGAGAGAAAGAGAGC. Internal right primer: GGGGCACTATTGCATCATCT. Internal WT amplicon: 2980 bp. Deletion size: 1978 bp. Deletion left flank: GTAGAATACGATCGGGGAGAGAAAGAGAGC. Deletion right flank: ACGAGACACCCGCACGTTTCCCTCGCGTGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1523 C. elegans dpl-1(gk685)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T23G7.1. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk685 homozygotes (sterile, with few eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATTTCCATCAGCAGTGAA. External right primer: ATACCGGCAGCAGCTAGAAA. Internal left primer: TTTGACAACAATCCAATCGC. Internal right primer: AGCTTGTCGGCTCAACGTAT. Internal WT amplicon: 2352 bp. Deletion size: 871 bp. Deletion left flank: ACAAACCAACCGGACTCAGACATTTTTCCA. Deletion right flank: TGGAAACCACAATTTTCAGACCGTAAAAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1636 C. elegans rsp-7&D2089.2(ok2079)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
D2089.1, D2089.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2079 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAATTACGTCGCCGGTTTA. External right primer: CACTGTTTTTCGGAGCCAAT. Internal left primer: ACATTTCGACATCGGCTACC. Internal right primer: CACCTCAACTTATTCGGGGA. Internal WT amplicon: 3201 bp. Deletion size: 1429 bp. Deletion left flank: TAAGCCATTTCTCGAAGAAAACAAAGCACA. Deletion right flank: AGATCCAAAGATCGAAAGCGTGACAAGAAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC170 C. elegans cki-1(gk132)/mIn1 [dpy-10(e128) mIs14] II. Show Description
T05A6.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and gk132 homozygotes (embryonic arrest). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1710 C. elegans dsh-2(ok2164)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C27A2.6. Homozygous marginally viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2164 homozygotes (mostly sterile; eggs sometimes hatch into abnormal larvae that may grow to adult and reproduce). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACCAGACCCACTGCTGAG. External right primer: GAAGCTTTGCTCCGTACGAC. Internal left primer: TTCCGTGAGGAAATGGAGAC. Internal right primer: AATTGACCTGACCTTGGCTG. Internal WT amplicon: 2756 bp. Deletion size: 1177 bp. Deletion left flank: CACACTCATCTCCCATGACGTAGTAGCATT. Deletion right flank: TGGAGATATAAAACCTTTATAAAGTTACCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1739 C. elegans szy-4(ok2324)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C30B5.1, C30B5.2. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2324 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGGGGTACGGTCGAAAGTCT. External right primer: CCGACTGATCCTTATTCCGA. Internal left primer: AACACAGCGACGTCAGAATG. Internal right primer: GCAAGCATCATCGTCTTCAA. Internal WT amplicon: 2125 bp. Deletion size: 1066 bp. Deletion left flank: TCCAATTCAGATAGCAAACAGTGCATGCTT. Deletion right flank: GGTATCTTTAGTTTTATTTAAAATTTATGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1771 C. elegans apc-1(gk824)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
W10C6.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk824 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TATGTGGAACCGAAGGAAGG. External right primer: CAGGCGTTGTTCTTTCACAA. Internal left primer: GGTCTCAGTCACCGGAGAAG. Internal right primer: ATTCAATGACCAACACGGCT. Internal WT amplicon: 2186 bp. Deletion size: 1963 bp. Deletion left flank: TGGAAGAATGCGGAGACTACACGAAAAAAT. Deletion right flank: AAAGTTATGAATTATCGTGCATTCGAGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807. Formerly known as mat-2.
VC1783 C. elegans F49E12.6(gk835)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F49E12.6. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk835 homozygotes (arrest stage/phenotype undetermined). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGCTCTGGGAACTCTTCGAT. External right primer: GGAGTGGTCGGTGTTGAAGT. Internal left primer: TATTTGGTGACGTGGCATTG. Internal right primer: CCACGTGGTGATGACAACTC. Internal WT amplicon: 2404 bp. Deletion size: 812 bp. Deletion left flank: GGCATAGTTATGGTTTTTCTTATTCTATGT. Deletion right flank: TTTGGGATTGCTCTGTCAAAGATTTCTGAT. Insertion Sequence: TTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1788 C. elegans ast-1(ok2359)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T08H4.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2359 homozygotes (embryonic or early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATAGGCCACCAGCTTCTCAA. External right primer: CCCAACTACCAACACAGGCT. Internal left primer: GACAATAGCGAAGAGCCGTC. Internal right primer: TGTGATCAAGTATTCGGCCA. Internal WT amplicon: 2386 bp. Deletion size: 946 bp. Deletion left flank: CACAGATAATAGAGCTTTTTGGAGCAGCAC. Deletion right flank: TTCATCGTCGTCGCCGAATCATCGGCGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1790 C. elegans ech-4(ok2291)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
R06F6.9. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2291 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGGTGAGTTTCGTTGGAAAT. External right primer: AAATGCTGCTCAAAAGCGAT. Internal left primer: ATTTCAGGCGTTCAGGATTG. Internal right primer: AACTTTTGTTGCCCGATTTG. Internal WT amplicon: 2356 bp. Deletion size: 1254 bp. Deletion left flank: GCGCAGAAAAATCTGAAAACTCTGAAGGAA. Deletion right flank: AATATCAACTGCTTTGCTCATCAAGAACTA. Insertion Sequence: AA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1794 C. elegans mop-25.2(ok2073)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Y53C12A.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2073 homozygotes (sterile with very occasional progeny). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATCTGAGCAAGTCGATGG. External right primer: TCTCCTCTGCGATTTTCCTC. Internal left primer: CGGAAAGGGGATGGATATTT. Internal right primer: ACCGGTTTCCCAAATTTTTC. Internal WT amplicon: 2262 bp. Deletion size: 1677 bp. Deletion left flank: TCACAAATGATAATTGTGGTTTTTTTTTGA. Deletion right flank: TTCGATAGCTTTTTCGACTTTCCGCTCACT. Insertion Sequence: TAGCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1796 C. elegans ZK1127.5&ZK1127.12(ok2279)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK1127.5, ZK1127.12. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2279 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AATATGTTGCAAAGGACCGC. External right primer: CTCAGCACCTTCCAATCCTC. Internal left primer: TGAATTCTCACAATGGAGCG. Internal right primer: AAATCTGAGCCGGTCCTGTA. Internal WT amplicon: 3074 bp. Deletion size: 1999 bp. Deletion left flank: TTTAGTTTCTATTTGAGCTCAATCCTCAAA. Deletion right flank: ATCTACGGTAACAGTGTCCGATCTACGGTA. Insertion Sequence: GGAAGTGTGAAACATCTTTAGGACAGAGTGTCATAAATGTGCTTGCAAGTATTTGAGCA CTACTGTCAAGGGCACCTCCCATGTAAATTTGTTGAAGAAGAGCATGACCGGCTTCAAT TCCAATGTCTTCTGGAAGAATTGGAACTCCTGATTCGCCCTTCGGTCTTGAAATAGCTT CTGCTTGGTAGATAACACCCTCTGTCGTTTCGGCGGTTAAGAACAGACCATATCCTGGA GAAGCGCCACCAGCATCACCTTTCCGTTGATCAACAGTAATATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1810 C. elegans pyr-1(ok2391)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
D2085.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2391 homozygotes (sterile, eggs don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAGCAGCTGAAGAGTTGGG. External right primer: CTCTATTCGCCATCTGAGCC. Internal left primer: AGTTCTTGTCAGAGCCGCAT. Internal right primer: ATTAGCAGGGAAGGCACTCA. Internal WT amplicon: 3370 bp. Deletion size: 2034 bp. Deletion left flank: GGTGTCCGATCATGCTGACGGTTTCTCTCC. Deletion right flank: ATGGCAATTGACAATGGAATTCCCTTGATA. Insertion Sequence: GA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1832 C. elegans ifb-2(ok2420)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F10C1.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2420 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ACTCTGCTCCTGCTTTGCAT. External right primer: CCGAGTTATCGTGACCCACT. Internal left primer: AGCAGTGGGAGTGCAAGACT. Internal right primer: ACGTCGAATGATTTTGGGAG. Internal WT amplicon: 3175 bp. Deletion size: 2459 bp. Deletion left flank: TGAGGATCGTAACAAGGAGCTTGTGATTGA. Deletion right flank: ACCACCAGACTCAATTGTGATGGAATCTCA. Insertion Sequence: TATTGAAAACTTTTCAGGGTGATATTCCCAGTCTTCTTCAACAAGCTTCACCTCCAGGA GGAGTTAAATCTCCATCAGCTGTAGTATTTCCGCCTGTTTCCGCAGCTGTCGCTGCAAT CACTGAAATTTCTCCACAAAGTAGCTACTCATCAATTGTGCCAAAAGTGGAAACCGATC AAATCTCCCAACAACTATTTAAATGTTAGTTTTTTATGCGATACAATTATTGCATCAAA CTAATTTTCTCATGTTTCCAGCTCTTCCTTTGTGGTCATTCCAACAAACTCCTGGATTA CCTATCGGAATGGATCTATCACAACTTGTTTTCCAACAATCCTCTCCCGACAAAACAGT TTCACCTGTGAAATCAGAAGTTGTAGAAGAAACGAAACCAATCGCTTCTTCACAATTAA CACTTCACAGCTTCTCCGCATATGTCAAATGTAATAAGACAAGTTTAAGGACAGAACTC GTGAAGATTGAGAATACACTGGAAAAAGATGATATTGACATTTCTGTATTTTACGAAAA ATATCCGAAATTACTTCGAGAATTGTTCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1834 C. elegans C25H3.8(ok2438)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C25H3.8. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2438 homozygotes (sterile, lays no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCATCAGCTTCAACAACGA. External right primer: TGAAGCTTGGATGGTGTTCA. Internal left primer: CTTCCATCAGGCATCCAAGT. Internal right primer: CAAAGATGCTCGTGCTTTGA. Internal WT amplicon: 2972 bp. Deletion size: 1859 bp. Deletion left flank: CAAATTTTCAATTCTGATTGGTGGTGGATA. Deletion right flank: GAAGTTTGGTATTCCATTGAATCGATTGTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC185 C. elegans dpy-10(gk24) wrn-1(gk116)/mIn1 [dpy-10(e128) mIs14] II. Show Description
F18C5.2. Homozygous lethal deletion chromosome linked to dpy-10 mutation, balanced by GFP- and dpy-10-marked inversion. Heterozygotes are Dpy with relatively dim GFP expression in pharynx, and segregates Dpy dim GFP, Dpy bright GFP (mIn1 homozygotes) and gk116 homozygotes (embryonic/early larval arrest). Nature of dpy-10 lesion unknown; recessive lethality could be the result of this mutation. Pick Dpy dim GFP+ and check for correct segregation of progeny to maintain." Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1887 C. elegans dsh-2(ok2162)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C27A2.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2162 homozygotes (sterile, lays eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACCAGACCCACTGCTGAG. External right primer: GAAGCTTTGCTCCGTACGAC. Internal left primer: TTCCGTGAGGAAATGGAGAC. Internal right primer: AATTGACCTGACCTTGGCTG. Internal WT amplicon: 2756 bp. Deletion size: 1104 bp. Deletion left flank: TTGTAAGCATGCGCCTTTTTAACATAAGTC. Deletion right flank: AGTCTTTCTCTGCGTCTCCTCTTCTTGTGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1888 C. elegans mmaa-1(ok2514)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T02G5.13. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2514 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGATTGGTGCACTGGTCATT. External right primer: AATCACGATACCTTGGACGC. Internal left primer: TCGTTTCGAAATTCGTCCTC. Internal right primer: ATGCCTGGTGACGACTACCT. Internal WT amplicon: 2798 bp. Deletion size: 1179 bp. Deletion left flank: TTTAAGAACAAAAACGTACCAAATGTGCTA. Deletion right flank: ATAGAAATAAGAGATATCAAGTGTTGAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1889 C. elegans fars-3&F22B5.10(gk1029)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F22B5.10, F22B5.9. fars-3 is the new name for frs-2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1029 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTGTTGTTCCACCCACAAGA. External right primer: TGCCGTTTTCTGCTCTTTTT. Internal left primer: CAGCCAGATGCACTTTCTCA. Internal right primer: CATTTGGGAGTTTGGTGGAG. Internal WT amplicon: 1427 bp. Deletion size: 823 bp. Deletion left flank: TGCAGTTCATATTGGAAATCCAAAAACTCT. Deletion right flank: TATCACATGGCTTCTTGTGTATAGATCCGA. Insertion Sequence: C. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1914 C. elegans C47G2.3(ok2557)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C47G2.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2557 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAATCCGTCTGACTCCTCGT. External right primer: GCTGAAAATGAGGTTTGGGA. Internal left primer: GTTGCAAACCTGGGTGGTAG. Internal right primer: GTACTCCTCCCGGACAATGA. Internal WT amplicon: 2124 bp. Deletion size: 1307 bp. Deletion left flank: TTAGGGTTAGCTGGAAAATTTTTTGATTAA. Deletion right flank: CCGTTTTTGGGATCAATTGGTCTGCTATTC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1998 C. elegans C25H3.11(ok2632)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C25H3.11. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP o2632 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTGTTGAGCTTTGTTCCCA. External right primer: AAATCGATGAAAATTCCGCA. Internal left primer: AATCAACGCTCACTCGCTCT. Internal right primer: GGAATTCGAAAACCACGATG. Internal WT amplicon: 3051 bp. Deletion size: 1740 bp. Deletion left flank: CTCTCCTGGTTCCCATATTGTAGTTGGACG. Deletion right flank: ACTGTGTCATCTGATGCCTCGTCAATTCTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2013 C. elegans snr-3&rsp-5(ok2084)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T28D9.10, T28D9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2084 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGTTCCGCAAAGTGCATAAT. External right primer: CTAGGAAGAGCGCGAACAAC. Internal left primer: GTTGACTCGGAAAGCCGTAA. Internal right primer: AGGAAGCGGTGTCCTACTCA. Internal WT amplicon: 3125 bp. Deletion size: 1493 bp. Deletion left flank: AGTATAGGACGTTCGATACTCAAATTTGCT. Deletion right flank: CGTGATCGCAAACGTTCTCGCAGATCCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2033 C. elegans F49E12.6(gk896)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F49E12.6. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk896 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGCTCTGGGAACTCTTCGAT. External right primer: GGAGTGGTCGGTGTTGAAGT. Internal left primer: TATTTGGTGACGTGGCATTG. Internal right primer: CCACGTGGTGATGACAACTC. Internal WT amplicon: 2404 bp. Deletion size: 1777 bp. Deletion left flank: GTTTTGGGAATAAAGCATCTCACAAATAAA. Deletion right flank: CGAATCTACGATATTGTCAATGTAATGGAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC206 C. elegans fzy-1&cyp-44A1(ok312) unc-4(e120)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK177.6, ZK177.5. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and GFP- hDf35 unc-4 homozygotes (larval/sterile adult arrest). Pick fertile GFP WT to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2091 C. elegans C09H10.7(ok2381)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C09H10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2381 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAAATTTCCAGGTTCGTCGT. External right primer: TTCCTGTTCGAAACGAGGTT. Internal left primer: GTGGATGCTCCAACTGACAA. Internal right primer: TGACGATTTGAATGTCTGATACAA. Internal WT amplicon: 1330 bp. Deletion size: 456 bp. Deletion left flank: TTCAAAATGGAGTTTGATATCAAAAAAGTG. Deletion right flank: ATCAGAAGGAGAAGACGCATCGGATTTATA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2151 C. elegans E02H1.5&E02H1.6(ok2819)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
E02H1.5, E02H1.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2819 homozygotes (late larval arrest or sterile with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGACGTCGGTTTATGCAGC. External right primer: CCATGGTGTGCTCATTTTTG. Internal left primer: CCGGCATTCAAGTCAAATCT. Internal right primer: GGCAAGTTCGCAGATTCTTT. Internal WT amplicon: 2609 bp. Deletion size: 1622 bp. Deletion left flank: ACAATAATTAACCAAATTCCAGACGATAAT. Deletion right flank: CATTTCAGATCGTTTGGACAGTGATGAAGG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2165 C. elegans F33H1.4(gk953)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F33H1.4. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk953 homozygotes (arrest stage/phenotype undetermined). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AGGCCATTCCTTGAAAGGTT. External right primer: GCTAGTAGTCGCTGATCCCG. Internal left primer: GAGGTACCCGTAGATCGCAA. Internal right primer: CGAAATCCGTTCTCCATCAT. Internal WT amplicon: 2555 bp. Deletion size: 836 bp. Deletion left flank: TTGCTCCAAATGCGGGAATTGAAGATAATA. Deletion right flank: GAAGATCGTATTGGTAGATCTGATTTAATG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2186 C. elegans F41G3.10(ok2840)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F41G3.10. Homozygous viable deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2840 homozygotes (sickly Unc with small broods, often Dpy, various morphological defects; population can be maintained with difficulty). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GGATCATTCGAGTGGGAAGA. External right primer: GTCCACTAAACTTTGCCCCA. Internal left primer: AAATTGAGGATGGATGACGC. Internal right primer: AAACTCCCACGAAATCATGC. Internal WT amplicon: 1146 bp. Deletion size: 795 bp. Deletion left flank: TGTTGCAATAAGAACGCATAGCTGTACAAT. Deletion right flank: GTGTCTAACTGTGAACGAGTGGGCTTTTAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2226 C. elegans cgt-3(ok2877)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59G1.1. Apparent homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2877 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATTCTGGACAGCGTTTGCTT. External right primer: CCATGATTAAACCAGACGGG. Internal left primer: TCAATCCATTGGGCATTTTT. Internal right primer: GGAATTACCTGCAATGGCTC. Internal WT amplicon: 1331 bp. Deletion size: 689 bp. Deletion left flank: AGATAATAATTTATACGAGAATATAGAATC. Deletion right flank: GGTTTCGTCATTTCTCGATAGAATTTGCAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2308 C. elegans stc-1(ok2829)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F54C9.2. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2829 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAACCGCCAACGAGTACAAT. External right primer: CAACGGGATCATTGCTAGGT. Internal left primer: GCTAAAGCTGCCGTAATTGG. Internal right primer: TGGATTACCTCCACCACCTC. Internal WT amplicon: 1183 bp. Deletion size: 642 bp. Deletion left flank: TGCTTGAGTTACAAAAACTCCTCCTTGAAG. Deletion right flank: TCATTAAAACTTACAAGAAAGCAACGACAC. Insertion Sequence: TTAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2351 C. elegans F52H3.4(ok2786)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F52H3.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2786 homozygotes (probable embryonic arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TTAGCGAAGCATTTTTGCCT. External right primer: CGACCCGAAGAATTGACATT. Internal left primer: GGAAAAACGCGACTGTCAAT. Internal right primer: CACGAAAATTATCGGGATGC. Internal WT amplicon: 1138 bp. Deletion size: 467 bp. Deletion left flank: AGTTCATGCAAGACTGAACAAGAAGACCAC. Deletion right flank: CTGAAAGTGTTTCAAGAAGGCATGGTATCG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2382 C. elegans ZK930.1(ok3132)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK930.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3132 homozygotes (larval arrest). This strain exhibits a high level of sterility or near-sterility in heterozygotes and mIn1 homozygotes, but populations can be maintained. Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GATAGGTGGATGGCTGGAAA. External right primer: CGAAATGTTGGCTCATCTCA. Internal left primer: TCTCCTTGGCTTCTGTGTCC. Internal right primer: GCTCACTTGGCTCTTCGTCT. Internal WT amplicon: 1200 bp. Deletion size: 789 bp. Deletion left flank: TGTCCAACACGGTGCGTTCATAAATTACAA. Deletion right flank: TTGTCCAACATCAGCCCATCGGACGAAACC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2383 C. elegans F54B3.3(ok3093)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F54B3.3. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3093 homozygotes (mid-larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CCGGAAAATCTGTTTTGCAT. External right primer: CGTAATCGAGTCCGGAATGT. Internal left primer: CACCATCCCAAGCTTCAATC. Internal right primer: CGAAAAGTGTCTTTCCGGTT. Internal WT amplicon: 1152 bp. Deletion size: 391 bp. Deletion left flank: ATGCAGGAAGAAAGCCTCCGAAAACAAGAA. Deletion right flank: TCACTCCACTTGAAGTACTCAAACACCCAA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2417 C. elegans ZK1127.4(ok1940)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK1127.4. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok1940 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GAAAAATGGATTGCCGAAGA. External right primer: GGGAAGTTCGTAATCGGTGA. Internal left primer: TTTCAGGCCAAATGTCCTTC. Internal right primer: CTGACAGCTCACACCACGAT. Internal WT amplicon: 2174 bp. Deletion size: 1250 bp. Deletion left flank: TGGAAGCATTCGTGAAGATTTGTCCGGCTT. Deletion right flank: CCTTCACGGTTGGCCCTGCTTTGAAGCTTG. Insertion Sequence: AGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2473 C. elegans ptc-2(ok3196)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F21H12.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3196 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGACTGCGAACATTGGGTAG. External right primer: CATACCGGGAGTCTGCTTTC. Internal left primer: CAAGACCGAGTGTCGACTGA. Internal right primer: TGGCCAGAAGTGATGTCTGA. Internal WT amplicon: 1140 bp. Deletion size: approximately 600 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2508 C. elegans ptp-2(ok3252)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59G1.5. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3252 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CAGTATCTGTCGAAACGCGA. External right primer: CCTGAGAAAATGGGAAGCAA. Internal left primer: CGACGACCAGTTAATGCTGA. Internal right primer: TGATGACGTGGAAGAAGTGC. Internal WT amplicon: 1163 bp. Deletion size: 652 bp. Deletion left flank: GGTCGACGACCAGTTAATGCTGAAAAGAAT. Deletion right flank: TCGTTGTTCATTGTAGTGCTGGAATTGGTA. Insertion Sequence: CG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2509 C. elegans ZK430.1(ok3194)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK430.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3194 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TATTTCAGGAGTTGCGGGAC. External right primer: GTCCCATTTCTCTCCGTTCA. Internal left primer: TGATACAGAATTCGCCAACG. Internal right primer: CATTCGGTCGCCTTATTGAT. Internal WT amplicon: 1374 bp. Deletion size: 812 bp. Deletion left flank: TCGAAAAGCTTCTTCTGGAACTTTCTCCGT. Deletion right flank: CTTATAGAAACTATTGAAGATGCTTCGATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2538 C. elegans C08B11.3(gk1041)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
C08B11.3. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP gk1041 homozygotes (sterile adult). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: ATCTCGATCGACACTTCGCT. External right primer: TAACATATCGACGTTGGGCA. Internal left primer: ACGGCTCGTCTGTTCTGATT. Internal right primer: AATTGACGGATCCACCTGAG. Internal WT amplicon: 2394 bp. Deletion size: 561 bp. Deletion left flank: GATCAATCTGAAATTCATTTTTCAAATTAT. Deletion right flank: TGCAAAATCGATTTCGTTCGGCAATCCAGA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2635 C. elegans ZK1248.1(ok3390)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
ZK1248.1. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3390 homozygotes (sterile adult, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GCCTTTCGTCGTTTTTCATC. External right primer: AGTGAATTTCGGTCAATCGG. Internal left primer: GCGCTCAGGATAATAGAACAA. Internal right primer: TTCTGTTTGAATTCCTCGCA. Internal WT amplicon: 1190 bp. Deletion size: 590 bp. Deletion left flank: ATTTTGGTTCCTTACTGTTTGTTAGAGCTT. Deletion right flank: GAAACCAGTAAGTGATAATTTCCTTTTTCA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2646 C. elegans lrr-1(ok3435)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F33G12.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3435 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAGTCCGATTTTGCAGCTTG. External right primer: TCCCCAGTGCTCTTTTATCG. Internal left primer: AACCATTTGATCATTGGCATT. Internal right primer: CCATGTGAAGTGGTTTTTGC. Internal WT amplicon: 1116 bp. Deletion size: 563 bp. Deletion left flank: AGGCTTTATCAGGTCTCCGTAAATCGATAG. Deletion right flank: GATTAACTCCGGCATTTGCTTTATAACGTG. Insertion Sequence: AC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2664 C. elegans R05H5.4(ok2875)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
R05H5.4. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok2875 homozygotes (sterile, no eggs). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCTCCACCAACGTAACACCA. External right primer: ACTCTTCTTGGCAGTGCGAT. Internal left primer: ATTCGGATCCACAGACTTCG. Internal right primer: AAGAGAACAAGCAAGACGGC. Internal WT amplicon: 1173 bp. Deletion size: 616 bp. Deletion left flank: ACATTCCAAAGTCAGCCATCTTGACGACTC. Deletion right flank: AGAAGTTTTTCCACCGATCTTCGCCGTCTT. Insertion Sequence: TCTTT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2680 C. elegans F54D10.7(ok3404)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F54D10.7. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3404 homozygotes (sterile with few eggs that don't hatch). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: GCCGAGATTTGGAGAAATGA. External right primer: AAGGCGCAGGACAACTACAT. Internal left primer: CAACAACATTCACAATCTTCATCA. Internal right primer: TGTGTGTCCTTTTCCCGTTT. Internal WT amplicon: 1124 bp. Deletion size: 643 bp. Deletion left flank: CTTAATTCCAGCTTCCTCAAGAGTTTGATT. Deletion right flank: TTTCTTTGTTGAAAGCGTCTTGGATCTTCT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2737 C. elegans B0495.7(ok3607)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
B0495.7. Maternal effect lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3607 homozygotes (first-generation homozygotes viable and fertile, but F2 arrests as grotty L1 or L2). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: AAACTCAGGATTGATCGCGT. External right primer: TTGGTGTGAATCGTCTCGAA. Internal left primer: ACACATTGGCTGATGGCATA. Internal right primer: CGTCCATCTGGATGTTTTGA. Internal WT amplicon: 1316 bp. Deletion size: 797 bp. Deletion left flank: GCAATGATAAGAAGCATTGTAATTACCATT. Deletion right flank: TCCCTTCTTCGGACCAATTCTCACAACGAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2763 C. elegans myrf-1(ok3445)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F59B10.1. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3445 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TCCGTAGTTTCGGTTATGCC. External right primer: AGCTTTGCTGGTATTGACGG. Internal left primer: TCAAGGACATAAAGAGCTGACA. Internal right primer: GTCAGCAACAGGCAATCAGA. Internal WT amplicon: 1381 bp. Deletion size: 636 bp. Deletion left flank: GAAGACAAGCGGCCATAATGGAAACCAAGG. Deletion right flank: ACAGGGCTCCTCCATTTCGTTGCCATCCAA. Insertion Sequence: GCTCCTACAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC277 C. elegans pkc-3(ok544)/mIn1 [dpy-10(e128) mIs14] II. Show Description
F09E5.1. Heterozygotes are WT with semi-dominant GFP expression in pharynx. Segregates WT GFP, Dpy GFP mIn1 homozygotes and ok544 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2775 C. elegans cct-2(ok3438)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
T21B10.7. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok3438 homozygotes (early larval arrest). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: CGATCCTGAAGTCAATCGGT. External right primer: CAGCAACCTCTCCTTTCTCG. Internal left primer: TCCTCAAAGAAGCCGAGAAA. Internal right primer: AATGAACAAACCGATTCCCA. Internal WT amplicon: 1112 bp. Deletion size: 633 bp. Deletion left flank: AAGATTCTCATTGCCAACACACCAATGGAC. Deletion right flank: GACTCGGCTGAACTTGTCACAAGACTCCGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807