More Fields
Strain Species Genotype
BR5706 C. elegans byIs193; bkIs10. Show Description
byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Worms have severe locomotion defect and slow growth. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
BR5944 C. elegans byIs193. Show Description
byIs193 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. F3 pro aggregation fragment is expressed at low levels (line B); hard to detect by western blot. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
BR6427 C. elegans byIs194; bkIs10. Show Description
byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. bkIs10 [aex-3p::hTau V337M + myo-2p::GFP]. Tau anti-aggregation double transgenic line generated by crossing byIs194 x bkIs10. Normal locomotion. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
BR6516 C. elegans byIs194. Show Description
byIs194 [rab-3p::F3(delta)K280 I277P I380P + myo-2p::mCherry]. Pan-neuronal over-expression of the F3 pro aggregation fragment of the human Tau protein with K280 deleted and two isoleucines to proline substitutions in the hexapeptide motifs of the repeat region (line B). These mutations abrogate the aggregation, making this strain an anti-aggregation control for BR5270. Reference: Fatuouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
BR6563 C. elegans byIs161; bkIs10. Show Description
byIs161 [rab-3p::F3(delta)K280 + myo-2p::mCherry]. bkIs10 [aex-3p::h4R1NtauV337M + myo-2p::GFP]. Strain co-expressing the F3(delta)K280 pro-aggregation Tau fragment and full-length Tau in all neurons. Worms have severe locomotion defect and slow growth. Red and green fluorescence in the pharynx due to the co-injection markers. bkIs10 contains an integrated transgene encoding the 1N4R isoforms of human tau with the 337M FTDP-17 mutation. Expression is driven by the pan-neuronal promoter aex-3. Over-expression of this transgene results in a pronounced Unc phenotype. Derived by additional outcrossing of BR5485. Reference: Fatouros C, et al. Hum Mol Genet. 2012 Aug 15;21(16):3587-603.
CA756 C. elegans ieSi1 II; itIs37 IV. Show Description
ieSi1 [htp-3p::GFP::him-8 + unc-119(+)] II. itIs37 [pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV. ieSi1 is prone to silencing; GFP might not be visible at lower magnifications. Reference: Wynne DJ, et al. J Cell Biol. 2012 Jan 9;196(1):47-64.
CB7080 C. elegans eEx754. Show Description
eEx754 [ilys-3p::ilys-3::mCherry::unc-54 3'UTR + sur-5p::GFP]. Pick GFP+ to maintain. Translational reporter for ilys-3. Reference: Gravato-Nobre et al. (2016) PMID: 27525822.
CB7272 C. elegans ccIs4251 I; mIs12 II; dpy-17(e164) III; frIs7 IV; uIs69 V. Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. mIs12 [myo-2p::GFP + pes-10p::GFP + F22B7.9p::GFP] II. frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. uIs69 [pCFJ90(myo-2p::mCherry) + unc-119p::sid-1] V. Mapping strain. This strain is homozygous for integrated fluorescence markers on LG I, II, IV and V, all of which are easily and independently scored using a fluorescent dissecting microscope, plus an easily scored visible marker (dpy-17) for LGIII. The good markers on all five autosomes facilitate linkage assignment of unmapped mutations, and enable rapid replacement of chromosomes when outcrossing heavily mutagenized strains such as those from the Million Mutation Project.
CER444 C. elegans sftb-1(cer114[mCherry::sftb-1]) III. Show Description
Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
CLP215 C. elegans twnEx8. Show Description
twnEx8 (mec-7p::tomm20::mCherry + myo-2p::GFP). Punctate mCherry signals denote mitochondria in six touch neurons. Pick animals GFP+ in the pharynx to maintain. Reference: Jiang HC, et al. Proc Natl Acad Sci U S A. 2015 Jul 14;112(28):8768-73.
CU7905 C. elegans smIs350 IV; unc-76(e911) V. Show Description
smIs350 [hsp-16::mCherry-NLS + tra-2::FLAG(3x) + unc-76(+)] IV. Some sterility. Maintain under normal conditions. Reference: Mapes J, et al. (2010) PNAS In press.
CX17256 C. elegans kyIs722. Show Description
kyIs722 [str-2p::GCaMP5(D380Y) + elt-2::mCherry]. GCaMP5a expression driven by str-2 promoter, providing a very bright integrated calcium indicator useful for imaging of AWC(on).
CYA2 C. elegans rexIs2. Show Description
rexIs2 [hsp-16p::tom70::mCherry::halo + mec-7p::mRFP]. Array is prone to silencing; pick RFP animals to maintain array. Constitutive red fluorescence in touch-receptor neurons. Heat-shock promoter drives expression of mCherry with tom70 (outer mitochondrial membrane targeting sequence from yeast) and Halo protein. Global red fluorescence upon heat-shock (37°C). Integrated into N2 background; insertion site not known. Reference: Long MJC, et al. Biochemistry. 2017 Sep 12. doi: 10.1021/acs.biochem.7b00642.
CZ18412 C. elegans juSi94 II; rps-18(ok3353) IV; glo-4(ok623) V; juEx5515. Show Description
juSi94 [GFP11::rps-18 + Cbr-unc-119(+)] II. juEx5515 [unc-25p::GFP1-10 + unc-25p::mCherry::rab-3 + ttx-3p::RFP]. Pick ttx-3::RFP to maintain. GABAergic motor neuron-specific expression of split GFP reporter allows visualization of ribosomes in neurons, and GABAergic motor neuron-specific expression of mCherry::rab-3. Reference: Noma et al Elife. 2017 Aug 2;6. pii: e26376. doi: 10.7554/eLife.26376.
CZ22695 C. elegans juEx6908. Show Description
juEx6908 [nmr-1p::PH::miniSOG(Q103L) + nmr-1p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Interneuron expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator). Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ22698 C. elegans juEx6911. Show Description
juEx6911 [unc-25p::PH::miniSOG(Q103L) + unc-25p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in GABAergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ22703 C. elegans juEx6916. Show Description
juEx6916 [myo-3p::PH::miniSOG(Q103L) + myo-3p::mCherry + ttx-3::GFP]. Pick GFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in body wall muscles. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ23279 C. elegans juEx7103. Show Description
juEx7103 [unc-17p(beta)::PH::miniSOG(Q103L) + acr-2p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in cholinergic motor neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271. [NOTE: strain was previously described as carrying ttx-3::GFP, but appears to be ttx-3::RFP instead.]
CZ23281 C. elegans juEx7105. Show Description
juEx7105 [mec-4p::PH::miniSOG(Q103L) + mec-4p::mCherry + ttx-3::RFP]. Pick RFP+ to maintain. Expression of mCherry and PH-miniSOG (mini Singlet Oxygen Generator) in mechanosensory neurons. Reference: Xu S & Chisholm AD. Sci Rep. 2016 Feb 10;6:21271.
CZ8332 C. elegans juIs223 IV. Show Description
juIs223 [ttr-39p::mCherry + ttx-3p::GFP] IV. Transcriptional reporter with ttr-39 promoter driving mCherry expression in DD and VD neurons. Reference: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265.
CZ9236 C. elegans juIs252 V. Show Description
juIs252 [mec-4p::mCherry + ttx-3p::RFP] V. mCherry expression in touch neurons. Reference: Knowlton WM, et al. Front Neurosci. 2017 May 10;11:263. doi: 10.3389/fnins.2017.00263. Chuang M, et al. 2014 Cell Rep, 9, 874-83.
DA2356 C. elegans ced-1(e1735) I; ced-3(n717) IV; lin-15B&lin-15A(n765) X; adEx2342. Show Description
adEx2342 [efl-3::mCherry::FLAG + LIN-15(+)]. Maintain by picking non-Muv. Fluorescence is dim, but array is stable (>95% transmission).
DCR1337 C. elegans nsIs105 I; cima-1(wy84) IV; wyIs45 X; olaEx805. Show Description
nsIs105 [hlh-17p::GFP] I. wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx805 [hlh-17p::caspase12 + hlh-17p::caspase17 + ttx-3p::mCherry + glr-3p::mCherry + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Ablation of CEPsh glia partially suppresses AIY presynaptic maintenance defects in cima-1(wy84) mutants. nsIs105 (hlh-17::GFP) expression labels CEPsh glia. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR1673 C. elegans olaEx987. Show Description
olaEx987 [ttx-3p::mCherry::rab-3 + hlh-17p::CD4::GFP(1-10) + ttx-3p::CD4::GFP11 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx987 labels AIY presynaptic sites with mCherry, and AIY and CEPsh contact with GFP. oleEx987 contains GRASP (GFP Reconstitution Across Synaptic Partners) constructs using two GFP fragments, GFP(1-10) and GFP11, that can reconstitute a functional GFP molecule only when they are in close proximity. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR2188 C. elegans olaEx1316. Show Description
olaEx1316 [ttx-3p::CD4::GFP11 + glr-3p::CD4::GFP(1-10) + ttx-3p::mCherry::rab-3 + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1316 labels AIY presynaptic sites with mCherry, and AIY and RIA contact with GFP. oleEx1316 contains GRASP (GFP Reconstitution Across Synaptic Partners) constructs using two GFP fragments, GFP(1-10) and GFP11, that can reconstitute a functional GFP molecule only when they are in close proximity. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.
DCR4750 C. elegans olaIs35 X. Show Description
olaIs35 [ttx-3Gp::eGFP::lgg-1 + ttx-3Gp::mCherry + unc-122p::RFP]. Integrated transgene allows visualization of autophagosomes in a single neuron (AIY). "ttx-3G" refers to genomic fragment containing AIY motif described in Bertrand & Hobert Dev Cell. 2009 Apr;16(4):563-75. References: Stavoe AK, et al. Dev Cell. 2016 Jul 25;38(2):171-85. Hill SE, et al. Dev Cell. 2019 Mar 8. pii: S1534-5807(19)30104-2.
DE115 C. elegans dnSi8 I; unc-119(ed3) III; dnIs22. Show Description
dnSi8 [tdp1::flag::mCherry + Cbr-unc119(+)] inserted into ttTi5605 on LG II. Nuclear-localized mCherry. dnIs22 [sup-46::GFP + unc-119(+)] (site of integration unknown). Strong nuclear-localized GFP expression. [NOTE: This strain was produced by crossing two parental strains carrying strong unc-119 loss of function alleles. One parent was carrying ed3; the allele in the other parental strain is unknown.]
DE130 C. elegans unc-119(e2488) III; dnIs24. Show Description
dnIs24 [sup46::flag::mCherry + Cbr-unc-119(+)]; site of integration unknown. Strong nuclear-localized mCherry.
DE90 C. elegans oxIs318 II; unc-119(ed3 or e2498) ruIs32 III; ddIs6 V; dnIs17. Show Description
oxIs318 [spe-11p::mCherry::histone + unc-119(+)] II. ruIs32 [pie-1p::GFP::histone H2B + unc-119(+)] III. ddIs6 [tbg-1::GFP + unc-119(+)] V. dnIs17 [pie-1p::GFP::hPLCIII?PH domain + unc-119(+)]. Maintain under normal conditions. Pick GFP+ to maintain. Reference: Johnston et al. (2010) Curr Biol.
DG2160 C. elegans tnIs13 ltIs44 V. Show Description
tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)].
DG2189 C. elegans fog-3(q443) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); tnIs13 ltIs44 V. Show Description
tnIs13 [pie-1p::vab-1::GFP + unc-119(+)]. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)]. Homozygous hT2[bli-4 let-? qIs48] are inviable. Homozygous fog-3(q443) animals are females.
DMS640 C. elegans nIs470 IV. Show Description
nIs470 [cysl-2p::GFP + myo-2p::mCherry] IV.  The cysl-2::GFP reporter is activated by HIF-1 in egl-9, rhy-1 or vhl-1 loss-of-function mutants.
EEG107 C.elegans tph-1(mg280) II; mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. When tph-1 mutants carrying mudIs1 are exposed to blue light, the worms continue to move rather than stopping like wild-type animals. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
EEG108 C. elegans mod-5(n822) I; mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
EEG98 C. elegans mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
EG4883 C. elegans oxIs318 II; unc-119(ed3) III. Show Description
oxIs318 [spe-11p::mCherry::histone + unc-119(+)]. Wild type. Dim mCherry expression in hermaphrodite sperm. Barely visible on bright dissection microscope; visible on compound microscope. Plasmid pCFJ167 inserted by MosSCI into ttTi5605 site.
EG4887 C. elegans oxIs322 II; unc-119(ed3) III. Show Description
oxIs322 [myo-2p::mCherry::H2B + myo-3p::mCherry::H2B + Cbr-unc-119(+)]. Wild type worms with mCherry fluorescence in pharyngeal and body wall muscle. Visible on dissection microscope at high magnification. Complex transgene insertion in place of Mos1 allele ttTi5605. Useful for following "invisible" insertions at ttTi5605 site by Mos1 Single Copy gene Insertion (MosSCI). Please note: The insertion was a complex event pulling in more than one transgene and parts of the array. Therefore, the exact molecular structure of the insert is not known. Therefore the strain should NOT be used as a control for insert copy number or other detailed molecular controls of MosSCI insertions. Succesfully used as a balancer for the ttTi5605 locus.
EG5025 C. elegans oxIs351 X. Show Description
oxIs351 contains [unc-47p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type.
EG5027 C. elegans oxIs353 V. Show Description
oxIs353 contains [myo-3p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type.
EG5096 C. elegans oxIs364 X. Show Description
oxIs364 contains [unc-17p::channelrhodopsin::mCherry + lin-15(+) + Litmus]. Superficially wild-type.
EG5568 C. elegans dpy-13(ox495::Cbr-unc-119(+) + myo-2p::mCherry + unc-122p::GFP) IV. Show Description
dpy-13(ox495::Cbr-unc-119(+) + myo-2p::mCherry + unc-122p::GFP) IV. Dpy, mCherry pharyngeal muscle, dim GFP+ in coelomycytes. Insertion/deletion into cxTi10882 MosSCI site on Chr. IV. Can be used as balancer.
EG6053 C. elegans oxSi212 II; unc-119(ed3) III. Show Description
oxSi212 [pie-1p::GFP::mCherry::H2B::gld-2 3'UTR::operonGFP::H2B::cye-1UTR] II. Maintain under normal conditions; expression is stable. Superficially wildtype. Bright, nuclear mCherry and GFP fluorescence in germline. Reference: Frokjaer-Jensen C, et al. Nat Methods. 2012 Jan 30;9(2):117-8.
EG6629 C. elegans oxIs565 II; oxTi80 III; oxSi199 IV. Show Description
oxIs565 [dpy-30p::frt::mCherry::frt::GFP::H2B + Cbr-unc-119(+)] II. Ubiquitous mCherry expression. Green nuclei after FLP activity. Integration into ttTi5605 mosSCI site (II:0.77). oxTi80 [eft-3p::GFP::H2B::tbb-2 3'UTR + unc-18(+)] III. Nuclear, green fluorescence is broadly expressed (in most cells). Integration into chr. III: 21.21. oxSi199 [unc-57p::tdTomato + unc-119(+)] IV. Synaptic red fluorescence visible on fluorescence dissecting scope. Integration into cxTi10882 mosSCI site (IV:-0.05). Combined fluorescent balancer strain for LG II, LG III and LG IV.
EG6787 C. elegans oxSi487 II; unc-119(ed3) III. Show Description
oxSi487 [mex-5p::mCherry::H2B::tbb-2 3'UTR::gpd-2 operon::GFP::H2B::cye-1 3'UTR + unc-119(+)] II. MosSCI insertion into ttTi5605 site on Chr II. unc-119 rescue, bright nuclear GFP and nuclear mCherry fluorescence in germline.
EG7309 C. elegans unc-119(ed3) III; oxTi417 V. Show Description
oxTi417 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7841 C. elegans oxTi302 I; unc-119(ed3) III. Show Description
oxTi302 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7910 C. elegans unc-119(ed3) III; oxTi420 IV. Show Description
oxTi420 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7915 C. elegans unc-119(ed3) III; oxTi419 IV. Show Description
oxTi419 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7921 C. elegans unc-119(ed3) III; oxTi414 IV. Show Description
oxTi414 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.
EG7926 C. elegans unc-119(ed3) III; oxTi418 IV. Show Description
oxTi418 [eft-3p::mCherry::tbb-2 3'UTR + Cbr-unc-119(+)]. Broad, cytoplasmic red fluorescence. pCFJ660 inserted into unc-119(ed3) III (11X outcross) background. Please see www.wormbuilder.org for exact insertion site.