Temperature sensitive dauer constitutive. Dpy. Leaky double at 25C.

Temperature sensitive dauer constitutive. Unc.

Temperature sensitive dauer constitutive. Dominant Twitcher

Temperature sensitive dauer constitutive. Unc.

sup-7 suppress dauer formation. sup-7 should be grown between 22.5C and 24C.

Temperature sensitive dauer constitutive. Small. Amber. Maintain at 15C.

Temperature sensitive dauer constitutive. Tight at 25C. Leaky at 15C. Chemotaxis normal.

Heterozygotes are WT and segregate WT, Sterile Uncs and Dpys. bli-4 is suppressed by dpy-18 in hT2 homozygotes-only see a very few DpyBli.

Temperature sensitive. Early larval arrest at 25C. At 20C, Lon, PVul, Muv, Mog, ectopic Hox gene expression.

tmIn20 is an inversion between F46C5.9 and C08H9.13 in LG II.  Inversion strain obtained by Next-generation sequencing.

tmIn21 is an inversion between pck-3 and R09H10.5 in LG IV.  Inversion strain obtained by Next-generation sequencing.

tmIn26 homozygotes are Lon and Mec. Break points: In(lon-2 mec-10) X. Covered region (Mb) 3.7 (4.7..8.5) Lon Mec. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.

Break points: In(unc-23 lon-3) V. Covered region (Mb) 3.3 (8.9..12.2) Lon Unc. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

tmIn51 is a CRISPR/Cas9-induced inversion between C09G12.5 and C01B10.3 in LG IV.

Break points: In(hpr-9 ttr-52) III. Covered region (Mb) 2.8 (10.6..13.4) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(srbc-66 T10H9.8) V. Covered region (Mb) 3.1 (3.5..6.7) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(gsp-3 sre-23) I. Covered region (Mb) 3.5 (4.7..8.3) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(odr-7 F59F4.2) X. Covered region (Mb) 3.4 (12.5..15.8) Unknown if tmIn60 homozygotes are Odr. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(kvs-5 dmd-9) IV. Covered region (Mb) 2.5 (0.7..3.3) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: In(dnj-27 dkf-1) I. Covered region (Mb) 1.8 (11.9..13.6) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Homozygous viable. 612 bp deletion. 17154/17155 - 17766/17767. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Homozygous viable. Received from Limor Broday. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Superficially wild-type.

Superficially wild-type.

Slow growing. Reduced brood size. Hypersensitive to oxidative stress.

rtSi1 [sod-1p::sod-1(WT) + Cbr-unc-119(+)] (inserted into cxTi10882) IV. Superficially wild-type. HA2619 serves as a control strain for HA2464. Reference: Baskoylu SN, et al. PLoS Genet. 2018;14(10):e1007682.

At 20C or 25C, heterozygotes are WT and segregate WT, UncDaf and dead eggs. At 15C, heterozygotes are WT and segregate WT, Uncs and dead eggs.

pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490

No apparent phenotype. tm748 is a UV/TMP-induced gap-2 deletion allele generated by National Bioresource Project (see http://shigen.lab.nig.ac.jp/c.elegans/index.jsp?lang=englis h for info).

pe407 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490

pe408 suppresses the defects in salt-starve associative learning of casy-1(tm718). Reference: Ohno H, et al. Science. 2014 Jul 18;345(6194):313-7. PMID: 25035490

Daf-c strongly but not completely suppressed; some dauers visible at 25C. sa935 alone is moderate Daf-d (dauer defective) in plate starvation assays, and resistant to exogenous dauer pheromone. sa935 confers strong suppression of daf-8 and daf-14, weak suppression of daf-1, -4, -7. scd-2(sa935) single mutant looks WT. snb-1(md247) hypomorph is an excellent balancer for scd-2; snb-1 is immediately neighboring. Maintain at 15 degrees.

No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2).

C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4).

Serotonin and dopamine-deficient, bleach hypersensitive, general chemical hypersensitivity, fragile cuticle. 652 bp deletion removes entire first exon. Derived by outcrossing FX773 five times to N2.

Egl. Aldicarb-resistant.

Normal lifespan. Increased sensitivity to oxidative stress, osmotic stress, cold stress, and heat stress. Slow development, slow physiological rates (thrashing, defecation), and reduced fertility. van Raamsdonk J & Hekimi S. Proc Natl Acad Sci U S A. 2012 Apr 10;109(15):5785-90.

irIs83 contains [pMM824 (unc-119::mCherry) + pMM768 (end-3(+))]. isIs83 formed by spotaneous integration of an Ex array in an end-1,3(-) mutant background and was backcrossed to remove end-1,3(-). irIs83 is likely not integrated on LG III, V, or X.

nIs352 [eya-1p::GFP::eya-1 + rol-6(su1006)]. Rollers. Rescuing array was integrated in eya-1(tm759) background. Reference: Hirose T, Galvin BD, Horvitz HR. Proc Natl Acad Sci U S A. 2010 Aug 31;107(35):15479-84.

Egl (Vul). 90% penetrant. lesion: M78I.

Ric; very slightly slow and loopy movement. Aberrant EPG.

cuIs2 [myo-2c:: GFP + rol-6(su1006)]. daf-4(m72) is a temperature sensitive dauer constitutive mutant. Maintain at 15C. It was problematic to get cuIs2 homozygous in this background. Pick Rollers to maintain.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Temperature-sensitive; constitutive dauer formation at 25C.

ccIs55 [unc-54::lacZ + sup-7(st5)] V. Temperature-sensitive. Some dauer formation at 16C.

M79.4. Homozygous. Outer Left Sequence: CGAGAACTGAAACAAACGCA. Outer Right Sequence: TGATTTGATGTGCGCAATTT. Inner Left Sequence: AACCCACACCTCAACTTTCG. Inner Right Sequence: ATTGAACCATGTCTGACCGT. Inner Primer PCR Length: 1138 bp. Deletion Size: 505 bp. Deletion left flank: TTCAAATATCATCACTTTCTTATTTTCCGG. Deletion right flank: TATTTCAGGGCAACCAATTCAGTCACAAAA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

M79.4. Homozygous. Outer Left Sequence: CGAGAACTGAAACAAACGCA. Outer Right Sequence: TGATTTGATGTGCGCAATTT. Inner Left Sequence: AACCCACACCTCAACTTTCG. Inner Right Sequence: ATTGAACCATGTCTGACCGT. Inner Primer PCR Length: 1139 bp. Deletion Size: 268 bp. Deletion left flank: GAGTTTATTTTTTATTAACAATTATCTTTG. Deletion right flank: AACAAAAACCCAACTAATTTTGTGTGTTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Temperature-sensitive lethal. Maintain at 15C. At 16-20C: aldicarb-resistant, small, Unc-coily, slow-growing, slow pharyngeal pumping. At 25C: tight coils, virtually no movement, virtually no pumping, no growth, no long-term survival. The animals rapidly respond to temperature shift in either direction, even after more than an hour at the non-permissive temperature. Amino acid change: A499D Sequence data: AGAAAGCTGGAATTATTTAAGAAGG / C>A / TGTGCTCAAGCAGGTCAAGGTCACG (in direction of transcription). Reference: Rand JB. Genetics. 1989 May;122(1):73-80.

Heterozygotes are WT. hIn1 homozygotes are Unc. tm759 homozygous arrest as early larva with incomplete penetrance (60% at 25C, 50% at 20C, 30% at 18C, and 50% at 15C). Viable tm759 homozygotes show various postembryonic phenotypes (Unc, Dpy, Egl, Mig, Muv).

dvIs67 [tbb-6p::GFP + myo-3p::dsRed]. stxEx12 [eft-3p::pmk-3 S(EE)::SL2::mCherry]. Pick animals with mCherry expression in intestinal cells. Reference: Munkacsy E, et al. PLoS Genet. 2016 Jul 15;12(7):e1006133.

Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt//tgatgaaaattaattgtatt. The ife-1 gene is the third in an operon, but the deletion is contained completely within the ife-1 gene.