PJ1196 |
C. elegans |
daf-7(m62) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Temperature-sensitive; constitutive dauer formation at 25C. NOTE: m62 is an amber allele of daf-7, which is well suppressed by sup-7 in ccIs55 at 16C.
|
|
PJ1199 |
C. elegans |
daf-7(m62) III; ccIs55 V. Show Description
ccIs55 [unc-54::lacZ + sup-7(st5)] V. Maintain at 15C. Constitutive dauer formation at 25C.
|
|
QQ253 |
C. elegans |
daf-16(mgDf50) I; daf-2(m65) III; zuIs45 V. Show Description
zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V. Maintain at 15C. Derived from parental strains GA158 and JJ1473. Reference: Simske J & Dong Y. 2017). The role of DAF-2 In the transmission of maternal and paternal nutritional status during embryogenesis presented in International Worm Meeting.
|
|
RB2201 |
C. elegans |
M60.6(ok2981) X. Show Description
M60.6 Homozygous. Outer Left Sequence: cacgtacgaaaccccaaagt. Outer Right Sequence: agttgcacaatccttttcgc. Inner Left Sequence: ttctcctgagaaagaatttggttt. Inner Right Sequence: gttatcggaaacaacgacgg. Inner Primer PCR Length: 1302. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
RB883 |
C. elegans |
kqt-2(ok732) X. Show Description
M60.5. Homozygous. Outer Left Sequence: TCTTTGTCGGAGAAGCCACT. Outer Right Sequence: GCAAATTCAAAAGTTGGGGA. Inner Left Sequence: GAGAATGCCGGAAAATTCAA. Inner Right Sequence: TGGCAATAAAGTGACGCTTG. Inner primer WT PCR product: 3213. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
TP69 |
C. elegans |
pdi-2(tm689)/lon-2(e678) X. Show Description
Heterozygotes are WT and segregate WT , Longs, and strong Dpys which are Sterile. Maintain at 15 degrees.
|
|
UP3542 |
C. elegans |
lpr-3(cs231) X; csEx436. Show Description
csEx436 [lpr-3 (fosmid WRM619dE09) + myo-2p::mCherry]. Pick mCherry+ animals to maintain. cs231 is a Crispr/Cas9-induced null allele of lpr-3: a 13 nucleotide deletion in exon 1 results in frameshift. Homozygous mutants are embryonic lethal, but are rescued by csEx436 containing lpr-3(+) fosmid WRM619dE09. NOTE: lpr-3(cs231) should be considered the canonical allele as ok2351 also perturbs expression of adjacent gene lpr-6. Reference: Forman-Rubinsky R, Cohen JD and Sundaram MV. Genetics. 2017 Oct;207(2):625-642.
|
|
VJ311 |
C. elegans |
erm-1(tm677)/unc-63(x18) dpy-5(e61) I. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and erm-1 homozygotes which grow up to bagging adults with few progeny. Some of these hatch but die as L1s.
|
|
VJ317 |
C. elegans |
erm-1(tm677) I; sDp2 (I;f). Show Description
Animals which have lost the Dp grow up to bagging adults with few progeny. Some of these hatch but die as L1s.
|
|
WBM60 |
C. elegans |
uthIs248. Show Description
uthIs248 [aak-2p::aak-2(genomic aa1-321)::GFP::unc-54 3'UTR + myo-2p::tdTOMATO]. Ubiquitous GFP expression and pharynx-specific tdTomato expression. Small with slight developmental delay and reduced reproductive capacity. Some phenotypes silence quickly. Reference: Burkewitz K, et al. Cell. 2015 Feb 26; 160(5): 842-55.
|
|
WM65 |
C. elegans |
src-1(cj293) let-502(sb118)/hT1 I; +/hT1 V. Show Description
Heterozygotes are WT and segregate WT, Uncs that give dead embryos (src-1 homozygotes), dead eggs, and mid-larval lethals (hT1 homozygotes). src-1 is linked to an unknown Unc. [Feb 2005: Paul Mains has found a temperature-sensitive let-502 mutation (called sb118) linked to src-1 in this strain. Not sure if this is the Unc mutation mentioned here, or a third mutation on this chromosome.]
|
|
ZM607 |
C. elegans |
syd-2(ok217) X. Show Description
Egl. Backward stiff and slow moving. Sluggish. Can move fast when poked. Outer pairs: F59F5.6EL1 (TTGCATCTGCAAAAGAAACG); F59F5.6ER1 (GCTCCGAACGAAAGAAGTTG). Inner pairs: F59F5.6IL1 (AATCTCTAACCATGCGGTCG); F59F5.6IR1 (CGCGGGAATTATGCCTATTA).
|
|
ZM6523 |
C. elegans |
hpDf761 II; unc-119(ed3) III. Show Description
hpDf761 removes ins-4, ins-5, and ins-6. Reference: Hung WL, et al. EMBO J. 2013 Jun 12;32(12):1745-60.
|
|
ZM6539 |
C. elegans |
unc-39(hp701) V. Show Description
Sluggish, somewhat loopy. Reference: Lim MA, et al. Elife. 2016 Nov 18;5:e19887. doi: 10.7554/eLife.19887. PMID: 27855782
|
|
ZM6686 |
C. elegans |
hpIs289. Show Description
hpIs289 [nca-2p::nca-2::GFP + lin-15(+)]. Rescuing NCA-2::GFP transgene. Originally inserted into nca-2 unc-77 lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
|
|
ZM6725 |
C. elegans |
hpIs290. Show Description
hpIs290 [nca-1p::nca-1::GFP + lin-15(+)]. Rescuing NCA-1::GFP transgene. Originally inserted into nca-2; unc-77; lin-15 triple mutant background and twice outcrossed to N2. Reference: Xie L, et al. Neuron. 2013 Mar 20;77(6):1069-82. PMID: 23522043.
|
|
ZM6804 |
C. elegans |
hpIs270. Show Description
hpIs270 [rig-3p::FRT::stop::FRT::ChR2(H134R)::wCherry + nmr-1p::FLP + lin-15(+)]. ChR2 activation in AVA neurons upon exposure to blue light (470 nm). Slightly slow growth. Reference: Gao S, et al. eLife, 7, e29915. https://doi.org/10.7554/eLife.29915 PMID: 29360035
|
|