More Fields
Strain Species Genotype
ARM6 C. elegans wamSi6 II; unc-119(ed3) III. Show Description
wamSi6 [eft-3p::mTagBFP2::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mTagBFP2 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 1–10.
DA707 C. elegans eat-17(ad707) X. Show Description
Eat mutant. Stuffs corpus and isthmus. Abnormality in m6 and m7 contraction timing. Displays clumping behavior; isolated in an RC301 background, so it's likely to have the RC301 bor-1 mutation.
DLM6 C. elegans uwaSi3 II; unc-119(ed3) III. Show Description
uwaSi3 [dpy-7p::CERULEAN-VENUS::lgg-1 + unc-119(+)] II. MosSCI insertion into ttTi5605 II. lgg-1 tagged with oxCerulean-oxVenus double fluorescent protein (dFP) for monitoring autophagy in the hypodermis. Reference: Chapin H, et al. Aging (Albany NY). 2015 Jun;7(6):419-34.
DR6 C. elegans unc-1(m6) X. Show Description
Kinky Unc.
OH11061 C. elegans otIs381 V. Show Description
otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH11152 C. elegans otIs392. Show Description
otIs392 [eat-4(prom6)::GFP + ttx-3::DsRed]. Reference: Serrano-Saiz E, et al. Cell 2013. Oct; 155(3):659-73.
OH14420 C. elegans pals-22(ot811) III; otIs381 V; otEx6761. Show Description
otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6761 [pals-22(+) + ttx-3p::mChOPTI]; derived from PCR fragment containing the genomic pals-22 locus. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6761 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH14429 C. elegans pals-22(ot811) III; otIs381 V; otEx6769. Show Description
otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6769 [pals-22(fosmid) + myo-2p::mChOPTI]; derived from NotI digestion of WRM0616DC09. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6769 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15178 C. elegans pals-22(ot810) III; otIs381 V. Show Description
otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. pals-22(ot810) mutant shows transgene-silencing phenotype. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15179 C. elegans pals-22(ot811) III; otIs381 V Show Description
otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. pals-22(ot811) mutant shows transgene-silencing phenotype. Pan-neuronal nuclear GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
RW11852 C. elegans unc-119(tm4063) III; stIs11852. Show Description
stIs11852 [M6.3::H1-wCherry + unc-119(+)].
WRM6 C. elegans sprSi6 II; unc-119(ed3) III. Show Description
sprSi6 [mex-5p::MODC PEST::GFP::H2B::glp-1 (GBM UtoC) 3'UTR + Cbr-unc-119(+)] II. Reference: Farley BM, Ryder SP. Mol Biol Cell. 2012 Oct 3.
BB19 C. elegans adr-1(tm668) I. Show Description
Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60.
BB21 C. elegans adr-1(tm668) I; adr-2(ok735) III. Show Description
Reduced lifespan, chemotaxis defective, co-suppression of transgenes in somatic cells. Maintain under normal conditions. Reference: Hundley HA, et al. RNA. 2008 Oct;14(10):2050-60.
BB239 C. elegans adr-1(uu49) I; adr-2(uu28) III. Show Description
Chemotaxis deficient. Transgenes are silenced in this background. Reference: Reich DP, et al. Genes Dev. 2018 Feb 1;32(3-4):271-282. NOTE: In the referenced publication, irregularities were noted in the adr-1(gv6);adr-2(gv42) null strain, which were ascribed to background mutationsint hat strain. This strain -- adr-1(uu49);adr-2(uu28) -- was generated Crispr/Cas9 targeted mutation and phenotypes are more consistent with another null strain, adr-1(tm668);adr-2(ok735).
CA257 C. elegans him-8(tm611) IV. Show Description
37% XO self progeny. Recessive.
CP101 C. briggsae Cbr-puf-2(nm66)/Cbr-dpy-?(nm4) II. Show Description
Larval-lethal puf-2 deletion allele. Heterozygotes are WT (slightly Dpy) and segregate 25% Dpy, 50% wild-type heterozygotes, and 25% larval lethal (arrest L1-L2). Maintain by picking WT and checking for correct segregation of progeny. Map distance between nm4 and nm66 has not been preciely determined, but is tight enough that >90% of non-Dpy non-Lva progeny from double-heterozygotes retain the parental genotype. Reference: Liu Q & Haag ES. J Exp Zool. 2013 Part B.
CP161 C. briggsae Cbr-unc-119(nm67) III; nmIs7. Show Description
nmIs7 [Cni-mss-1(+) + Cni-mss-2(+) + Cbr-myo-2::GFP + unc-119(+)]. Insertion site of transgene is not known, but it is not in LG III or X. Males with this transgene are more competitive in siring progeny; also a higher ratio of males in the population. Derived from parental strain CP99, which in turn was derived from AF16. Reference: Yin D, et al. Science. 2018 Jan 5;359(6371):55-61.
CP87 C. briggsae Cbr-fem-3(nm63) IV. Show Description
XO are self-fertile hermaphrodites with low brood size and some somatic gonad defects. XX animals have normal brood size.
CP89 C. briggsae Cbr-fem-2(nm27) III; Cbr-fem-3(nm63) IV. Show Description
XX are self-fertile hermaphrodites.
CP99 C. briggsae Cbr-unc-119(nm67) III. Show Description
Derived from AF16. Outcrossed >6x to AF16. Unc, slightly Dpy, no dauer formation (similar to C. elegans unc-119). nm67 is a deletion (827 bp) in Cbr-119 begining in exon 1 and ending 3' of exon 4. Reference: Liu Q, et al. Development. 2012 Apr;139(8):1509-21.
CU2904 C. elegans scrm-1(tm698) I. Show Description
Mild defect in cell corpse engulfment.
DM612 C. elegans unc-2(ra612) X. Show Description
DQM662 C.elegans bmdSi200 I; bmdSi168 II. Show Description
bmdSi200 [loxN::pcn-1p::pcn-1::GFP] I. bmdSi168 [loxN::rps-27p::DHB::2x-mKate2] II. bmdSi200 is a single copy CRISPR/Cas9-engineered insertion of a full length pcn-1::GFP translational fusion under its own promoter. bmdSi168 is a single-copy CRISPR/Cas9-engineered insertion of a codon optimized CDK sensor (amino acids 994–1087 of human DNA Helicase B (DHB) fused to two copies of mKate2). Reference: Adikes RC, et al. "Visualizing the metazoan proliferation-terminal differentiation decision in vivo." bioRxiv 2019.12.18.881888
DR200 C. elegans daf-2(e1370) III; daf-13(m66) X. Show Description
Temperature sensitive dauer constitutive. Dauers SDS-sensitive.
DR215 C. elegans unc-1(e94) daf-13(m66) X. Show Description
Dauers SDS-sensitive. Unc.
DR410 C. elegans daf-2(m65)/unc-32(e189) III. Show Description
Heterozygotes are WT and segregate WT, dauer constitutive, and Uncs. Lethal dauers.
DR497 C. elegans unc-13(e450) I; daf-7(m62) III; sup-7(st5) X. Show Description
Both unc-13 and daf-7 are suppressed by sup-7. sup-7 should be grown between 22.5C and 24C.
DR62 C. elegans daf-7(m62) III. Show Description
Temperature sensitive dauer constitutive. 100% dauers at 25C. Some dauers (3.5%) at 15C.
DR63 C. elegans daf-4(m63) III. Show Description
Temperature sensititve dauer constitutive. Small. 100% dauers at 25C. 15% dauers at 15C.
DR66 C. elegans daf-13(m66) X. Show Description
SDS sensitive dauers. Non-crowder.
DR68 C. elegans unc-31(m68) IV. Show Description
Slow movement.
EM62 C. elegans mab-17(e2167) unc-15(e73) I; him-5(e1490) V. Show Description
Unc. Round bulging adult male tale. Very reduced fan. Mating efficiency is zero.
EM66 C. elegans him-5(e1490) V; vab-3(bx23) X. Show Description
Transformation of ray 6 to a thin ray which is anteriorly displaced and fuses with ray 4 (99%). Body is slightly shorter. See also WBPaper00002235.
EM67 C. elegans mab-20(bx24) I; him-5(e1490) V. Show Description
Extensive ray fusion. Posterior portion of body swollen at larval stages.
EM68 C. elegans col-34(bx25) IV; him-5(e1490) V. Show Description
Lumpy rays. Temperature sensitive. bx25 previously called ram-4.
FX19163 C. elegans mca-3(tm6395)/tmIn11 IV. Show Description
Homozygous lethal deletion allele balanced by Unc-marked translocation. Heterozygotes are wild-type and segregate wild-type heterozygotes, lethal tm6395 homozygotes, and Unc tmIn11 homozygotes. Break points: In(kvs-5 unc-17) IV. Covered region (Mb) 2.9 (0.7..3.6) [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX19181 C. elegans unc-15(tm6329)/tmIn14 I. Show Description
Homozygous lethal deletion allele balanced by Dpy-marked translocation. Break points: In(dpy-5 lin-10) I. Covered region (Mb) 2.7 (5.4..8.1) Dpy. [NOTE: the genotype originally listed for this strain in Table 2 of Dejima, et al. was incorrect.] Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.
FX627 C. elegans lgc-11(tm627) X. Show Description
No obvious phenotype. 446 bp deletion. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX659 C. elegans cdc-48.2(tm659) II. Show Description
Received new stock 10/30/08. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX683 C. elegans spas-1(tm683) V. Show Description
Superficially WT. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GA132 C. elegans daf-16(mgDf50) I; daf-2(m646) III. Show Description
Maintain at 15C.
GA158 C. elegans daf-16(mgDf50) I; daf-2(m65) III. Show Description
Maintain at 15C.
IG256 C. elegans xnp-1(tm678) I. Show Description
Temperature sensitive. Sterile at 25C. Larval lethal with lin-35 and hlp-2. The deletion extends 673 bp (and not 674 + 1 insertion as described on the S. Mitani website). The deletion breakpoint is AAAAAAAGAGCTGAAACATCGGAAGAGTCA/AGATGCAGAGAGAGCAGAGAAAGAGAGA AGA. B0041.7 Reference: Cardoso C, et al. Dev Biol. 2005 Feb 1;278(1):49-59.
JK1438 C. elegans daf-2(m65)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, non-conditional dauers, and Sterile Dpys. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JM69 C. elegans dpy-5(e61) unc-13(e1091)/szT1 [lon-2(e678)] I; elt-2(ca15)/szT1 X. Show Description
Heterozygotes are WT and segregate WT, Lon males and dead eggs.
MQ228 C. elegans mad-2(qm62) I. Show Description
Maternal effect dumpy. Adults are short but larvae are not. Animals are lethargic but display hyperactive foraging movement and very rapid pumping when stimulated by light touch. Hermaphrodite and male tails are abnormal. Very slow development. High degree of embryonic and larval lethality.
MQ499 C. elegans mad-3(qm64) V. Show Description
Maternal effect Dpy. High level of embryonic and larval lethality. Lethal at 25C. Males are Dpy.
MT19851 C. elegans sptf-3(tm607)/hIn1 [unc-101(sy241)] nIs425 I; nIs175 IV. Show Description
nIs425 [myo-2p::GFP] I. nIs175 [ceh-28p::4NLS::GFP + lin-15(+)] IV. Heterozygotes are GFP+ wild type and segregate GFP+ Unc, GFP+ wild type, and GFP- sptf-3 homozygotes. nIs425 was integrated into sptf-3(tm607)/hIn1[unc-101(sy241)] I. The position of integration appears to be close to or lie within the region covered by hIn1: sptf-3(tm607) heterozygotes are GFP+ whereas sptf-3(tm607) homozygotes do not express GFP in the pharynx. Reference: Hirose T, Horvitz HR. Nature. 2013 Aug 15;500(7462):354-8.
NM664 C. elegans jsIs37 IV; lin-15B&lin-15A(n765) X. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. Superficially wild-type. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope.