Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
DR185 C. elegans dpy-13(e184) unc-22(m52) IV. Show Description
Dominant Twitcher Unc. Semi-dominant Dpy.
DR245 C. elegans daf-14(m77) unc-22(m52) IV. Show Description
Temperature sensitive dauer constitutive. Dominant Twitcher
DR52 C. elegans unc-22(m52) IV. Show Description
Unc-Twitcher. Dominant. Genotype questionable.
WRM52 C. elegans mex-3(spr9[*tn1753]) I. Show Description
Homozygous fertile; reduced brood size. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp). Derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Reference: Albarqi MMY & Ryder SP. PLoS Genet 2021 Aug 23;17(8):e1009775. PMID: 34424904
WRM75 C. elegans mex-3(spr9[*tn1753]) I; ltSi539 II; ltSi507 IV; nre-1(hd20) lin-15B(hd126) X; stIs10389. Show Description
Homozygous fertile, nearly fully penetrant embryonic lethal phenotype at 25C. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp) derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. ltSi539 [dlg-1p(delta)7::mCherry::his-72::unc-54 3’UTR + cnd-1p::mCherry::his-72::unc-54 3’UTR + Cbr-unc-119(+)] II. ltSi507 [hlh-1p::GFP::his-72::tbb-2 3’UTR + hlh-1p::mCherry::his-72::tbb-2 3’UTR +Cbr-unc-119(+)] IV. stIs10389 [pha-4::TGF(3E3)::GFP::TY1::3xFLAG inserted into fosmid WRM0617dE06 as C-terminal protein fusion]. During embryogenesis, ectoderm fluoresces red, mesoderm fluoresces yellow, and endoderm/pharynx fluoresces green. Derived by crossing parental strains WRM52 and OD1854. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
WRM79 C. elegans mex-3(spr9[*tn1753]) I; sprSi1 II; unc-119(ed3) III. Show Description
Homozygous fertile, nearly fully penetrant embryonic lethal phenotype at 25C. sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp) derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Derived by crossing parental strains WRM52 and WRM1. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
WRM81 C. elegans mex-3(spr9[*tn1753]) I; pgl-1(spr20[mCherry::pgl-1]) IV. Show Description
Homozygous fertile, reduced brood at 25C. mCherry tag inserted at N-terminus of endogenous pgl-1locus in parental strain WRM52. mex-3(spr9) is a CRISPR/Cas9 engineered deletion of the mex-3 3´UTR (removes 624 of 689 bp) derived by modification of parental strain DG4269 mex-3(tn1753[gfp::3xflag::mex-3]) I. Homozygous fertile; reduced brood size. Reference: Brown HE, et al. Development. 2025 Sep 1;152(17):dev204740. doi: 10.1242/dev.204740. PMID: 40787769.
DR1099 C. elegans ama-1(m118m526) IV. Show Description
More resistant to alpha-amanitin than ama-1(m118). Will grow in the presence of 0.5% triton-X 100 with 100 ug/ml amanitin whereas ama-1(m118) will not. DR1099 displays temperature-sensitive defects consistent with defective RNA Pol II function. Sterile at 25C (maternal effect sterile). Fertile at 20C, but produces few viable progeny (~80% eggs that do not hatch). Periodically check for Emb to prevent spontaneously suppressed animals from taking over a population. Reference: Rogalski TM, et al. Genetics. 1990 Dec;126(4):889-98.
NM5209 C. elegans jsTi1453 jsSi1514 I; him-8(e1489) IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1514 [LoxP::RMCE mec-4p::GFP-C1::FRT3] I. RMCE insertion of mec-4 promoter driving GFP-C1. Reference: Nonet ML. Genetics. 2020.
NM5233 C. elegans jsTi1453 jsSi1518 I; jsTi1493 jsSi1515 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1518 [LoxP::UAS 11X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1515 [LoxP::mec-4p::GAL4-QF::FRT3] IV. RMCE derived single copy UAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p GAL-4-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
NM5274 C. elegans jsTi1453 jsSi1527 I; jsTi1493 jsSi1549 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1527 [LoxP::lexO 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1549 [LoxP::mec-4p::lexA-L-QF::FRT-3] IV. RMCE derived single copy lexO GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p lexA-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
NM5275 C. elegans jsTi1453 jsSi1517 I; jsTi1493 jsSi1551 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1551 [LoxP::mec-4p::QF::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
NM5276 C. elegans jsTi1453 jsSi1543 I; jsTi1493 jsSi1548 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1543 [LoxP::tetO 7X::(delta)mec-7p::(delta)mec-7p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1548 [LoxP::mec-4p::rtetR-L-QF::FRT3] IV. RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet ON mec-4p rtetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
RM523 C. elegans unc-17(cn355) IV. Show Description
cn355 behaves like other unc-17 hypomorphs (coily Unc, slow growth, aldicarb-resistant, etc.); however, the mutation is in the splice site necessary for generating unc-17 transcripts, so that unc-17 transcripts and UNC-17 protein are dramatically reduced (hence the unc-17 behavioral phenotypes), and the cha-1 transcripts, CHA-1 protein, and ChAT enzyme activity are significantly increased (Mathews et al., 2015). Note: UNC-17 and CHA-1 protein sequences are both completely wild-type; the phenotypes derive from the extremely low level of the (wild-type) UNC-17 protein. Flanking Sequences: AAATTTAGAAAAAATAAAATATTCC/ A>G /GGGGGAGAGAGAGAGATGGGCTTCA (in direction of transcription). Reference: Mathews EA, et al. Genetics. 2015 Mar;199(3):729-37.