OH3972 |
C. elegans |
otIs151; otEx2310. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2310 [gcy-19(prom1)::GFP + unc-122::GFP]. Expresses GFP in IL2, faint in ASEL/R, and faint pairs in head. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH3976 |
C. elegans |
otIs151; otEx2314. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2314 [gcy-2(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASI, RIA, PVT and AWA. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH3992 |
C. elegans |
otIs151; otEx2322. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2322[gcy-14(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASEL, and dim GFP in ASER and AWC. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH3997 |
C. elegans |
otIs151; otEx2327. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2327 [gcy-20(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASEL, dim in ASER and AWC. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH4158 |
C. elegans |
otIs151; otEx2409. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2409 [gcy-4(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASE, biased to right. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH4160 |
C. elegans |
otIs151; otEx2411. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2411[gcy-13(prom1)::GFP + unc-122::GFP]. Expresses GFP in RIM. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH4163 |
C. elegans |
otIs151; otEx2414. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2414 [gcy-17(prom1)::GFP + unc-122::GFP]. Expresses GFP in PHA. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH4165 |
C. elegans |
otIs151; otEx2416. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2416 [gcy-21(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASG and ADL(weak). Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH4168 |
C. elegans |
otIs151; otEx2419. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2419 [gcy-1(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASER, ASI, URX, PVT, and AIY. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH4172 |
C. elegans |
otIs151; otEx2423. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2423[gcy-3(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASER. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH4174 |
C. elegans |
otIs151; otEx2425. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2425 [gcy-25(prom1)::GFP + unc-122::GFP]. Expresses GFP in AQR, PQR, URX. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH4309 |
C. elegans |
otIs151; otEx2491. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2491[gcy-29(prom1)::GFP + unc-122::GFP]. Expresses GFP in ASE and AWC. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH4329 |
C. elegans |
lsy-6(ot71) dpy-11(e224) V; otEx2322. Show Description
otEx2322[gcy-14(prom1)::GFP + unc-122::GFP]. Faint ASE GFP expression (2 right). Expresses bright GFP in coelomocytes. Dpy.
|
|
OH4343 |
C. elegans |
otIs133 II; otEx2498. Show Description
otEx2498 [gcy-18(prom1)::GFP + rol-6(su1006)]. Expresses GFP in AFD and AIM. Maintain by picking GFP+ animals (which should also be Rollers). otIs133 [pttx-3::RFP + unc-4(+)]. RFP expressed in AIY only.
|
|
OH4346 |
C. elegans |
otIs151; otEx2501. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2501[gcy-23(prom1)::GFP + unc-122::GFP]. Expresses GFP in AFD. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH4348 |
C. elegans |
otEx2503. Show Description
otEx2503[gcy-27(prom1)::GFP + rol-6(su1006)]. Expresses GFP in ASK, ASI, ASJ. Maintain by picking GFP+ animals (which should also be Rollers).
|
|
OH4350 |
C. elegans |
otIs151; otEx2504. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2504 [gcy-28(prom1)::GFP + unc-122::GFP]. Expresses GFP in many head neurons, ventral cord and tail neurons, body wall muscle, hypodermis, somatic germline and intestine. Expresses bright GFP in coelomocytes. Rollers. Maintain by picking GFP+.
|
|
OH4397 |
C. elegans |
otIs151; lsy-6(ot71) dpy-11(e224) V; otEx2419. Show Description
otIs151 [ceh-36p::RFP + rol-6(su1006)]. Expresses RFP in AWCL/R and ASEL/R. otEx2419 [gcy-(prom1)::GFP + unc-122::GFP]. Bilateral expression of GFP in ASE. Expresses bright GFP in coelomocytes. Rollers. Dpy. Maintain by picking GFP+.
|
|
OH4400 |
C. elegans |
lim-6(nr2073) X; otEx2322. Show Description
otEx2322 [gcy-14(prom1)::GFP + unc-122::GFP]. ASEL biased GFP expression. Expresses bright GFP in coelomocytes.
|
|
OH7116 |
C. elegans |
lsy-22(ot114) unc-101(m1) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); otIs3 V. Show Description
otIs3 [gcy-7::GFP + lin-15(+)]. qIs48 [myo-2::GFP + pes-10::GFP + ges-1::GFP]. Homozygous hT2 animals are inviable. Heterozygotes are WT and GFP+. Homozygous lsy-22(ot114) unc-101(m1) animals are Unc and have a maternal effect embryonic lethal phenotype. Whole genome sequenced strain.
|
|
OH9545 |
C. elegans |
otIs287 IV. Show Description
otIs287 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] IV. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
|
|
OH9609 |
C. elegans |
otIs291 V. Show Description
otIs291 [rab-3(prom1)::2xNLS::YFP + rol-6(su1006)] V. Rollers. Pan-neuronal YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
|
|
PS6058 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; syEx1147. Show Description
syEx1147 [des-2::DES-2::GFP + pha-1(+) + pBluescript KS(+)]. Maintain at 25C to select for presence of transgene. GFP reporter is driven by the promoter of the des-2/des-3 operon and is expressed in ALA, RID, PVD, FLP, IL2, PLM, PVC, and M1 muscles of the pharynx. This construct contains 3.4 kb of sequence upstream of the des-2 start ATG (Treinin et al., 1998) (Van Buskirk and Sternberg, 2010).
|
|
PS7055 |
C. elegans |
syTi1 X. Show Description
syTi1 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3'] X. Mapped by Inverse PCR to Chromosome X: (13709433-13709434).
|
|
PS7058 |
C. elegans |
syTi2 II. Show Description
syTi2 [mos 5'-hsp-16.2 5'::fars-1(A, N, M1-G203)::gp41-1(N, C1-E88)::fib-1/rps-16::GFP::unc-54 3'-myo-2 5'::gp41-1(C, M1-S38)::fars-1(A, C, S204-K552, T468G)::rpl-16/M01F1.8::mCherry::let-858 3'-rpl-27 5'::neoR::unc-54 3'-mos 3']. Mapped by Inverse PCR to Chromosome II: (344975-344974).
|
|
SL536 |
C. elegans |
dxDf2/spe-9(eb19) unc-101(m1) I. Show Description
Heterozygotes are Unc and segregate Uncs, Sterile Uncs and dead eggs. Strain is sick and grows slowly. dxDf2 fails to complement unc-54, so it could delete the entire right arm of LG I.
|
|
WRM1 |
C. elegans |
sprSi1 II; unc-119(ed3) III. Show Description
sprSi1 [pie-1p::GFP::histone-H2B::nos-2(MRE mut) 3'UTR + Cbr-unc-119(+)] II. Nuclear GFP fluorescence in germline progenitor cells in early embryos. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
|
|
WRM2 |
C. elegans |
sprSi2 II; unc-119(ed3) III. Show Description
sprSi2 [pie-1p::GFP::histone-H2B::nos-2 3'UTR + Cbr-unc-119(+)] II. Fluorescence in all cells of early embryo. This fluorescence reporter has mutations in both MEX-3 binding sites and shows ectopic expression relative to strain WRM1. Reference: Pagano JM, et al. Proc Natl Acad Sci U S A. 2009 Dec 1;106(48):20252-7.
|
|
YS2 |
C. elegans |
cbp-1(bm1) dpy-18(e364)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. cbp-1 is embyronic lethal. ys2 is an internal deletion in cbp-1. NOTE: THIS STRAIN WAS FORMERLY IDENTIFIED AS HA1000 cbp-1(ys2) dpy-18(e364)/qC1 dpy-19(e1259) glp-1(q339) III. The strain name and allele were corrected per Anne Hart, 2010.
|
|
ABR339 |
C. elegans |
lpin-1(wbm76[lpin-1::GFP]) V. Show Description
GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
|
|
ABR9 |
C. elegans |
set-2(ok952) III; rbr-2(tm1231) IV. Show Description
Reduced lifespan. Maintain under normal conditions. The parental rbr-2 strain was outcrossed 6x and the parental set-2 strain was outcrossed 2x. Reference: Greer EL et al Nature (2010) doi: 10.1038/nature09195.
|
|
AD186 |
C. elegans |
egg-1(tm1071) III. Show Description
Temperature sensitive sterile. Maintain at 20C. Fertility is <10% of WT at 25C.
|
|
AD226 |
C. elegans |
egg-3(tm1191)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP tm1191 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
AD266 |
C. elegans |
egg-4(tm1508) egg-5(ok1781) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1508 ok1781 homozygotes (maternal sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Parry JM, et al 2009 Current Biology 19(20):1752-7.
|
|
AD319 |
C. elegans |
spe-38(syb6556[spe-38::wrmScarlet-I]) I; him-5(e1490) V. Show Description
wrmScarlet-I tag inserted into endogenous spe-38 locus. Him. wrmScarlet-I expression labels membranous organelles (MOs) in the sperm. Reference: Zuo Y, et al. Biomolecules. 2023; 13(4):623. https://doi.org/10.3390/biom13040623
|
|
ADS707 |
C. elegans |
unc-13(s69) I; aeaIs8; hpIs728. Show Description
aeaIs8 [ift-20p::GCaMP6s::3xNLS + lin-15(+)]. hpIs728 [gpc-1p::wCherry + lin-15(+)]. Unc. Nuclear-localized GCaMP6s expressed in ciliated sensory neurons. Cytoplasmic wCherry expression in a subset of neurons. Derived by crossing EG9631 (unc-13) hermaphrodites with ZM10104 (aeaIs8; hpIs728) heterozygous males. Reference: Lin A, et al. bioRxiv 2022.05.27.493772; doi: https://doi.org/10.1101/2022.05.27.493772.
|
|
AG248 |
C. elegans |
mus-101(tm1761) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous lethal deletion balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP+, arrested hT2 aneuploids, and non-GFP tm1761 homozygotes (embryonic lethal). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP+ and check for correct segregation of progeny to maintain. Reference: Jaramillo-Lambert A, et al. G3 (2015).
|
|
AGD397 |
C. elegans |
aak-1(tm1944) III; aak-2(ok524) X; uthEx202. Show Description
uthEx202 [crtc-1p::crtc-1 cDNA::tdTomato::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Mair W, et al. Nature. 2011 Feb 17;470(7334):404-8.
|
|
AM101 |
C. elegans |
rmIs110. Show Description
rmIs110 [F25B3.3p::Q40::YFP]. Pan-neuronal YFP expression. Reference: Gidalevitz T, et al., Science. 2006 Mar 10;311(5766):1471-4.
|
|
AM138 |
C. elegans |
rmIs130 II. Show Description
rmIs130 [unc-54p::Q24::YFP]. Diffuse distribution of Q24::YFP throughout the body-wall muscle cells.
|
|
AM140 |
C. elegans |
rmIs132 I. Show Description
rmIs132 [unc-54p::Q35::YFP]. AM140 animals show a Q35::YFP progressive transition from soluble to aggregated as they age.
|
|
AM141 |
C. elegans |
rmIs133. Show Description
rmIs133 [unc-54p::Q40::YFP]. AM141 animals show a soluble Q40::YFP distribution in body wall muscle cells immediately after hatching. As these worms age the rapid formation of foci is observed. When they reach adulthood, AM141 animals show an entirely Q40::YFP aggregated phenotype.
|
|
ARM101 |
C. elegans |
wamSi101 V; unc-119(ed3) III. Show Description
wamSi101 [eft-3p::mTFP::unc-54 3'UTR + Cbr-unc-119(+)] V. Expresses a single copy of mTFP from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
|
|
ARM103 |
C. elegans |
unc-119(ed3) III; wamSi103 V. Show Description
wamSi103 [eft-3p::mKO2::unc-54 3'UTR + Cbr-unc-119(+)] V. Expresses a single copy of mKO2 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
|
|
ARM112 |
C. elegans |
wamSi112 II; unc-119(ed3) III Show Description
wamSi112 [eft-3p::mScarlet::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mScarlet from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
|
|
ARM118 |
C. elegans |
wamSi118 II; unc-119(ed3) III. Show Description
wamSi118 [eft-3p::mCerulean3::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses a single copy of mCerulean3 from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
|
|
ARM123 |
C. elegans |
unc-119(ed3) III; wamSi123 V. Show Description
wamSi123 [eft-3p::mECitrine::unc-54 3'UTR + Cbr-unc-119 (+)] V. Expresses a single copy of mECitrine from eft-3 promoter; construct utilizes the unc-54 terminator and 3'UTR. Can be used as a standard for multicolor imaging and quantitative microscopy. Reference: Sands B, et al. 2018. Translational Medicine of Aging Volume 2, January 2018, Pages 110.
|
|
AUM1054 |
C. elegans |
gsk-3(tm2223) I/hT2[bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile tm2223 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
|
|
AUM1535 |
C. elegans |
drsh-1(viz43)/tmC18[dpy-5(tmIs1200[myo-2p::mVenus])] I. Show Description
[D943G] substitution mutation in conserved residue within RNAse III domain. Balancer marked with myo-2p::Venus. Pick fertile wild-type (non-Dpy) Venus+ to maintain. drsh-1(viz43) homozygous animals display heterochronic phenotypes beginning at L3/L4 molt and typically burst at the vulva in L4. Heterozygotes are wild-type with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus viz-43 homozygotes, and Dpy Venus+ tmC18 homozygotes. Reference: Barish S, et al. Human Mol Genet. 2022 Aug 25;31(17):2934-2950. doi: 10.1093/hmg/ddac085. PMID: 35405010.
|
|
AUM1830 |
C. elegans |
sart-3(tm6688)/tmC9 [F36H1.2(tmIs1221)] IV. Show Description
Homozygous sterile deletion balanced by tmC9 [F36H1.2(tmIs1221[myo-2p::Venus])]. Heterozygotes are wild-type Venus+ in pharynx, and segregate wild-type Venus+ heterozygotes, non-Venus Sterile (tm6688 homozygotes), and Venus+ Mec Unc (tmC9 homozygotes). Pick viable fertile Venus+ animals and check for correct segregation of progeny to maintain. Reference: Furuta T & Arur S. 2023. sart-3 functions to regulate germline sex determination in C. elegans. microPublication Biology. PubMed ID: 37206989.
|
|