More Fields
Strain Species Genotype
JIM113 C. elegans ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. Reference: Zacharias A, et al. PLoS Genet. 2015 Oct 21;11(10):e1005585.
JIM173 C. elegans unc-119(tm4063) III; ujEx173. Show Description
ujEx173 [ceh-36::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.
JIM193 C. elegans ujIs113 II; ujIs193. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs193 [nhr-67::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0633cC01 by recombineering. Expression of transgene confirmed by GFP.
JIN1375 C. elegans hlh-30(tm1978) IV. Show Description
Superficially wild-type. Grows at standard conditions. Reference: Settembre C, et al. Nat Cell Biol. 2013 Jun;15(6):647-58.
JJ1743 C. elegans par-6(tm1425)/hIn1 [unc-54(h1040)] I; him-8(e1489) IV. Show Description
Heterozygotes are WT and segregate WT, Uncs, dead larvae (par-6 homozygotes) and males.
JK4099 C. elegans hlh-2(tm1768) I. Show Description
Temperature sensitive sterile. Partially sterile at 20 C; completely sterile at 25 C. Maintain at <20 C. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JM1041 C. elegans ges-1(ca6ca7) V. Show Description
Phenotypically normal except that it does not show ges-1 activity. Mutations (ca6ca7) are presumably misense or nonsense but have not been characterized genetically.
JM124 C. elegans elt-4(ca16) X. Show Description
No obvious phenotype. Chromosomal deletion beginning from -42 bp to +1196 bps relative to elt-4 ATG (+20bp insert).
JM125 C. elegans caIs108. Show Description
caIs108 [ges-1p::YFP::actin + unc-119(+)].
JM126 C. elegans pho-1(ca101ca102) II. Show Description
Partial maternal effect lethal. Lack of PHO-1 acid phosphatase activity on isoelectric focusing gel.
JM130 C. elegans pho-1(ca101ca102) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozgyotes are WT and segregate WT, DpyUncs, and Unc Pho (slightly slow growing, about 15% shorter than WT and produce about 60% inviable embryos; early broods are less viable than later broods).
JM144 C. elegans mnDp1 (X;V)/+ V; lin-15B&lin-15A(n765) gob-1(ca17) X. Show Description
Animals with Dp/+ are WT. Animals which have lost the Dp arrest as L1 with Gob (gut-obstructed) phenotype. Animals with Dp/Dp are sterile homozygotes. gob-1(ca17) is a small deletion, removing nine genes between R03A10.4 and H13N06.4 (inclusive) and possibly the seven additional genes F39D8.2 to R03A10.3 and H13N05.6.
JM149 C. elegans caIs71. Show Description
caIs71[elt-2p::GFP::HIS-2B::unc-54 3'UTR + rol-6(su1006)]. Rollers. Expresses nuclear-localized GFP in all intestinal nuclei under control of 5.2 kb elt-2 promoter. GFP is fused to Histone H2B + (fused pie-1 and truncated unc-54 3'-UTR). Transgene was integrated into N2 background by exposure to gamma rays. Reference: Dineen A, et al. Dev Biol. 2018 Mar 15;435(2):150-161. PMID: 29360433
JMC245 C. elegans alg-4(tm1184) III; csr-1(tor67[csr-1 exon2::gfp::3xflag (IV:7958598)], csr-1(mg660[G120*])) alg-3(tm1155) IV; wago-10(tor133) V. Show Description
Quadruple mutant of four spermatogenesis-specific ago genes. Reference: Charlesworth AG, et al. Nucleic Acids Res. 2021 Sep 7;49(15):8836-8865. PMID: 34329465
JPS478 C. elegans asic-1(ok415) I; mec-10(tm1552) X; vxEx478. Show Description
vxEx478 [sto-5p::asic-1(+) + unc-122p::GFP]. Array rescues asic-1(lf) in FLP and BDU neurons. Pick GFP+ animals to maintain. Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.
JS345 C. elegans gck-1(km15) V/nT1 [qIs51] (IV;V). Show Description
Maintain by picking GFP+ wild-type worms. Heterozygotes segregate wild-type GFP+ heterozygotes, sterile GFP- gck-1 homozygotes, and dead eggs (nT1 homozygotes). Reference: Schouest et al, Plos ONE 4(10):e7450 (2009).
JT11069 C. elegans xbx-1(ok279) V. Show Description
Dyf. Osm. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).
KB7 C. elegans kgb-1(um3) kgb-2(km16) IV. Show Description
Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)]
KC565 C. elegans sin-3(tm1276) I; him-5(e1490) V. Show Description
Mab. Pvl. Throws males.
KIR1 C. elegans smc-4(tm1868) III/qC1 [dpy-19(e1259) glp-1(q339) qIs26] (III). Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. Rollers. Homozygous sterile deletion allele tm1868 balanced by qC1 with rol and GFP markers. Segregates GFP + Roller heterozygotes, and non-rol non-GFP tm1868 homozygotes (sick, sterile, unc). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Pick Rol GFP+ and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al., Curr Biol. 2009 Jan 13;19(1):9-19.
KIR2 C. elegans capg-2(tm1833) V/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP capg-2 homozygotes (sick, sterile, Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al., Curr Biol. 2009 Jan 13;19(1):9-19.
KM134 C. elegans mef-2(gv1) I; ayIs. Show Description
Slightly short and fat as adults. 1376 bp deletion of part of intron 1 through intron 4. Contains an integrated hlh-8::GFP reporter marking the postembryonic M lineage.
KM137 C. elegans mef-2(gv2) I. Show Description
760 bp deletion beginnin in exon 3 and ending in exon 4. No strong visible phenotype.
KM166 C. elegans cye-1(eh10)/dpy-14(e188) I. Show Description
Heterozygotes are WT and segregate WT, Dpys, and Sterile Pvl.
KN611 C. elegans axl-1(tm1095) I. Show Description
tm1095 enhances Q neuroblast migration and vulva induction phenotype of pry-1. Minor defect in excretory cell development. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48.
KN637 C. elegans axl-1(tm1095) I; muIs32 II; bar-1(ga80) X. Show Description
muIs32 [mec-7p::GFP + lin-15(+)] II. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48.
KN644 C. elegans pop-1(hu9) axl-1(tm1095) I; muIs32 II. Show Description
muIs32 [mec-7p::GFP + lin-15(+)] II. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48.
KN689 C. elegans axl-1(tm1095) pry-1(mu38) I; muIs32 II; huEx83. Show Description
muIs32 [mec-7p::GFP + lin-15(+)] II. huEx83 [pry-1p::axl-1::GFP + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48.
KU12 C. elegans dlk-1(km12) I. Show Description
KU801 C. elegans klc-2(km11) V. Show Description
Homozygous viable. km11 is a deletion/duplication of klc-2; see Sakamoto, et al. PMID: 15563606 for detailed description. Reference: Sakamoto R, et al. Mol Biol Cell. 2005 Feb;16(2):483-96. PMID: 15563606
LC80 C. elegans ptps-1(tm1984) I. Show Description
Serotonin- and dopamine-deficient, tetrahydrobiopterin-deficient, general chemical hypersensitivity, cuticle fragility (rapid disintegration in alkaline bleach), male turning defective (phenotypes appear identical to cat-4 null mutants). Derived by outcrossing FX1984 five times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.
LE2513 C. elegans tiam-1(tm1556) I; ced-10(n1993) lqIs3 IV. Show Description
lqIs3 [osm-6::GFP] IV. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.
LE2514 C. elegans tiam-1(tm1556) I; mig-2(mu28) lqIs2 X. Show Description
lqIs2 [osm-6::GFP + lin-15(+)]. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.
LE2517 C. elegans tiam-1(tm1556) I; lqIs2 X. Show Description
lqIs2 [osm-6::GFP + lin-15(+)].Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.
LE2717 C. elegans unc-73(rh40) tiam-1(tm1556) I; lqIs2 X. Show Description
lqIs2 [osm-6::GFP + lin-15(+)]. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.
LE3190 C. elegans tiam-1(tm1556) I; juIs76 II; mig-2(mu28) lqIs2 X. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs2 [osm-6::GFP] X. lqIs2 carries a PDE/amphid/phasmid marker linked to mig-2. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.
LE3191 C. elegans tiam-1(tm1556) I; juIs76 II; ced-10(n1993) lqIs3 IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs3 [osm-6::GFP] IV. lqIs3 carries a PDE/amphid/phasmid marker linked to ced-10. Reference: Demarco RS, et al. PLoS Genet. 2012;8(4):e1002665.
LH202 C. elegans gtl-2(tm1463) IV. Show Description
Slow growing and lethargic, scrawny, egl, constipated.
LP322 C. elegans nmy-2(ne3409) hmr-1(cp21[hmr-1::GFP + LoxP]) I. Show Description
Maintain at 15C. Semi-permissive at 20C. 100% lethal at 25C. cp21[hmr-1::gfp + LoxP] I males were crossed to WM179 nmy-2(ne3409) hermaphrodites. Fluorescence in early embryos, larvae, and adults. Severe cytokinesis defects in early embryos at 25°C. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.
LSC27 C. elegans pdf-1(tm1996) III. Show Description
T07E3.6 deletion mutant.
LSC90 C. elegans pdf-1(tm1996) III; lstIs1. Show Description
lstIs1 [pdf-1p::pdf-1::3'UTR + elt-2p::GFP]. pdf-1 over-expressing line with wild-type locomotion. Reference: Janssen T, et al. J Biol Chem. 2008 May 30;283(22):15241-9.
LW905 C. elegans lmn-1(tm1502) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP tm1502 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
MAC1 C. elegans atx-3(tm1689) V. Show Description
Superficially WT.
MH3084 C. elegans ain-2(tm1863) I; ain-1(ku322) X. Show Description
Double mutants displayed a severe defect in seam-cell development, implicating a retarded heterochronic phenotype. Protruding vulva phenotype. Increased number of seam cells. Reference: Zhang L, et al. Mol Cell. 2007 Nov 30;28(4):598-613. PMID: 18042455
MH5197 C. elegans nprl-3(ku540) IV. Show Description
Superficially wildtype. Homozygous nprl-3(ku540) can suppress the early larval arrest phenotype of mmBCFA deficiency mutants elo-5(gk208) and cgt-1(tm1027) cgt-3(tm504). References: Zhu H, et al. Elife. 2013 May 21;2:e00429. Zhu H, Sewell AK, Han M. Genes Dev. 2015 Jun 15;29(12):1218-23.
MQ1050 C. elegans daf-16(m26) I; isp-1(qm150) IV. Show Description
Slow development.
MQ1236 C. elegans clk-1(e2519) III; rte-5(qm197) X. Show Description
qm197 suppresses the L2 arrest and sterility of clk-1(e2519) on UQ- bacteria.
MQ1343 C. elegans dsc-1(qm133) X. Show Description
Pale. Short defecation cycle length. Expulsion defective.
MQ1395 C. elegans clk-1(e2519) III; rte-1(qm199) X. Show Description
qm199 suppresses the growth arrest and sterility of clik-1(e2519) on ubi- bacteria.
MQ1766 C. elegans sod-2(ok1030) I; sod-5 (tm1146) sod-1(tm783) II; sod-4(gk101) III; sod-3(tm760) X. Show Description
Normal lifespan. Increased sensitivity to oxidative stress, osmotic stress, cold stress, and heat stress. Slow development, slow physiological rates (thrashing, defecation), and reduced fertility. van Raamsdonk J & Hekimi S. Proc Natl Acad Sci U S A. 2012 Apr 10;109(15):5785-90.