Heterozygotes are slightly Dpy, and segregate slightly Dpy mlt-7/tmIn4 heterozygotes, Dpy tmIn4 homozygotes, and mlt-7(tm1794) homozygotes (Let). Break points: In(lin-8 dpy-2) II. Covered region (Mb) 3.7 (3.1..6.7) Dpy. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.

Homozygous lethal deletion allele balanced by Unc-marked translocation. Break points: In(jtr-1 unc-17) IV. Covered region (Mb) 2.2 (1.4..3.6) Unc. Reference: Iwata S, et al. Sci Rep. 2016 Sep 21;6:33840.

Superficially wild-type.

Homozygous sterile allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (tm1310 is maternally rescued; progeny of non-GFP animals fail to give viable progeny). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Castellano-Pozo, García-Muse T, Aguilera A. 2012 R-loops cause replication impairment and genome instability during meiosis. EMBO Rep. 13(10): 923-9.

Maintain by picking Unc GFP progeny that produce viable embryos and checking that the non-GFP progeny that are produced fail to give viable progeny. tm1310 is a homozygous sterile allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are Unc with pharyngeal GFP signal, and segregate Unc GFP, arrested hT2 aneuploids, and non-GFP sterile homozygotes (tm1310 is maternally rescued; progeny of non-GFP animals fail to give viable progeny). Homozygous hT2 [bli-4 let-? qIs48] inviable. ok79 heterozygotes are Unc and segregate Uncs, dead eggs, and Him ok79 homozygotes (maternally rescued). Reference: Castellano-Pozo, García-Muse T, Aguilera A. 2012 R-loops cause replication impairment and genome instability during meiosis. EMBO Rep. 13(10): 923-9.

Enhances retarded differentiation of the hypodermis and exit from the molting cycle caused by mutations in let-7 or its paralogs. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.

Retarded differentiation of the hypodermis and supernumerary molt that results in adult lethality. Reference: Hayes GD, Frand AR, Ruvkun G. Development. 2006 Dec;133(23):4631-41.

Him. Mutator. RNAi-defective. Temperature-sensitive sterile at 25C. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.

gwIs4 [myo-3p::RFP + baf-1::GFP-lacI:::let-858 3'UTR] X. Worms are slow growing, with reduced brood size and become sterile at elevated temperatures. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. RFP expression in muscles. Reference: Gonzalez-Sandoval A, et al. Cell. 2015 Dec 3;163(6):1333-47. doi: 10.1016/j.cell.2015.10.066. PMID: 26607792.

gwIs39 [baf-1::gfp-lacI::let-858 3'UTR + vit-5::GFP] III. gwIs58 [hsp-16.2p::mCherry::256xLacO::4xLexA + unc-119(+)]. Small transgene/large array. Slow growing and dumpy. Expresses GFP-LacI from early embryogenesis and throughout development, which forms a small spot at the lacO array. Worms have green intestine (from late L4 stage). Might still carry unc-119(ed3) in background. Reference: Rohner S, et al. J Cell Biol. 2013 Mar 4;200(5):589-604. doi: 10.1083/jcb.201207024. PMID: 23460676

Flipping defective. Reference: Schwarz J & Bringmann H. eLife 2017;10.7554/eLife.24846.

Temperature sensitive. Maintain at 15C. Unc.

Heterozygotes are green and segregate green WT, dead eggs and nonGreens that lay dead eggs with the defects in spindle organization, chromosome segregation, and cytokinesis.

quEx182 [npr-9(+) + sur-5::GFP + odr-1::RFP]. Maintain by picking GFP+. Rescuing npr genomic fragment co-injected with sur-5::GFP and odr-1::RFP]. transgenic (GFP+) animals tend to wander off the food.

nuIs5 [glr-1::GFP + glr-1::G(alpha)s(Q227L) V + lin-15(+)] V. Reference: Tehrani N, et al. (2014) PLoS One 9(11):e113060.

jcpSi10 [ints-6p::ints-6::3xFLAG::eGFP::ints-6 3'UTR + unc-119(+)] II. Superficially wild-type. ints-6 previously known as dic-1. Reference: Gómez-Orte E, et al. PLoS Genet. 2019 Feb 26;15(2):e1007981.

axIs1709 [pie-1p::GFP::histone H2B:lip-1M1M2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Transgene is slightly unstable. Pick non-Unc, GFP+ worms to maintain.

axIs1775 [pie-1p::GFP::histone H2B:gld-1 M1M2 3'utr + unc-119(+)]. Transgene is prone to silencing -- maintain at 25C. Pick wild-type worms to maintain.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. Reference: Zacharias A, et al. PLoS Genet. 2015 Oct 21;11(10):e1005585.

ujEx173 [ceh-36::TY1::EGFP::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. Reference: Walton T, et al. PLoS Genet. 2015 Mar 4;11(3):e1005003.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)] II. ujIs193 [nhr-67::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence in fosmid ID#WRM0633cC01 by recombineering. Expression of transgene confirmed by GFP.

Superficially wild-type. Grows at standard conditions. Reference: Settembre C, et al. Nat Cell Biol. 2013 Jun;15(6):647-58.

Heterozygotes are WT and segregate WT, Uncs, dead larvae (par-6 homozygotes) and males.

Temperature sensitive sterile. Partially sterile at 20 C; completely sterile at 25 C. Maintain at <20 C. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.

Phenotypically normal except that it does not show ges-1 activity. Mutations (ca6ca7) are presumably misense or nonsense but have not been characterized genetically.

No obvious phenotype. Chromosomal deletion beginning from -42 bp to +1196 bps relative to elt-4 ATG (+20bp insert).

caIs108 [ges-1p::YFP::actin + unc-119(+)].

Partial maternal effect lethal. Lack of PHO-1 acid phosphatase activity on isoelectric focusing gel.

Heterozgyotes are WT and segregate WT, DpyUncs, and Unc Pho (slightly slow growing, about 15% shorter than WT and produce about 60% inviable embryos; early broods are less viable than later broods).

Animals with Dp/+ are WT. Animals which have lost the Dp arrest as L1 with Gob (gut-obstructed) phenotype. Animals with Dp/Dp are sterile homozygotes. gob-1(ca17) is a small deletion, removing nine genes between R03A10.4 and H13N06.4 (inclusive) and possibly the seven additional genes F39D8.2 to R03A10.3 and H13N05.6.

caIs71[elt-2p::GFP::HIS-2B::unc-54 3'UTR + rol-6(su1006)]. Rollers. Expresses nuclear-localized GFP in all intestinal nuclei under control of 5.2 kb elt-2 promoter. GFP is fused to Histone H2B + (fused pie-1 and truncated unc-54 3'-UTR). Transgene was integrated into N2 background by exposure to gamma rays. Reference: Dineen A, et al. Dev Biol. 2018 Mar 15;435(2):150-161. PMID: 29360433

Quadruple mutant of four spermatogenesis-specific ago genes. Reference: Charlesworth AG, et al. Nucleic Acids Res. 2021 Sep 7;49(15):8836-8865. PMID: 34329465

vxEx478 [sto-5p::asic-1(+) + unc-122p::GFP]. Array rescues asic-1(lf) in FLP and BDU neurons. Pick GFP+ animals to maintain. Reference: Russell J, et al. Proc Natl Acad Sci USA. 2014 Jun 3;111(22):8269-74.

Maintain by picking GFP+ wild-type worms. Heterozygotes segregate wild-type GFP+ heterozygotes, sterile GFP- gck-1 homozygotes, and dead eggs (nT1 homozygotes). Reference: Schouest et al, Plos ONE 4(10):e7450 (2009).

Dyf. Osm. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).

Deletion alleles. Can be maintained at 20C. Sterile at 26C. Can use PCR with the following primer to determine whether both deletions are present. (5'end)5'GGTCTACCAGAGTTTGTGCGCAATC3' (3'end)5'GATAGCCTTGCACTTCGTTG3'. PCR products from wild type show two bands; kgb-1 gene shows a smaller band; kgb-2 gene shows a bigger band.The double mutant should have no PCR product. [NOTE: The 5' primer sequence was corrected 03/28/12 (K. Bennett)]

Mab. Pvl. Throws males.

qIs26 [lag-2::GFP + rol-6(su1006)]. Rollers. Homozygous sterile deletion allele tm1868 balanced by qC1 with rol and GFP markers. Segregates GFP + Roller heterozygotes, and non-rol non-GFP tm1868 homozygotes (sick, sterile, unc). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. Pick Rol GFP+ and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al., Curr Biol. 2009 Jan 13;19(1):9-19.

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP capg-2 homozygotes (sick, sterile, Unc). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Csankovszki G, et al., Curr Biol. 2009 Jan 13;19(1):9-19.

Slightly short and fat as adults. 1376 bp deletion of part of intron 1 through intron 4. Contains an integrated hlh-8::GFP reporter marking the postembryonic M lineage.

760 bp deletion beginnin in exon 3 and ending in exon 4. No strong visible phenotype.

Heterozygotes are WT and segregate WT, Dpys, and Sterile Pvl.

tm1095 enhances Q neuroblast migration and vulva induction phenotype of pry-1. Minor defect in excretory cell development. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48.

muIs32 [mec-7p::GFP + lin-15(+)] II. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48.

muIs32 [mec-7p::GFP + lin-15(+)] II. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48.

muIs32 [mec-7p::GFP + lin-15(+)] II. huEx83 [pry-1p::axl-1::GFP + myo-2p::GFP]. Pick animals with GFP+ pharynx to maintain. Reference: Oosterveen et al. (2007) Dev Biol 308: 438-48.

Homozygous viable. km11 is a deletion/duplication of klc-2; see Sakamoto, et al. PMID: 15563606 for detailed description. Reference: Sakamoto R, et al. Mol Biol Cell. 2005 Feb;16(2):483-96. PMID: 15563606

Serotonin- and dopamine-deficient, tetrahydrobiopterin-deficient, general chemical hypersensitivity, cuticle fragility (rapid disintegration in alkaline bleach), male turning defective (phenotypes appear identical to cat-4 null mutants). Derived by outcrossing FX1984 five times to N2. Reference: Loer CM, et al. Genetics. 2015 May;200(1):237-53.