NM5274 |
C. elegans |
jsTi1453 jsSi1527 I; jsTi1493 jsSi1549 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1527 [LoxP::lexO 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1549 [LoxP::mec-4p::lexA-L-QF::FRT-3] IV. RMCE derived single copy lexO GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p lexA-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
|
|
NM5275 |
C. elegans |
jsTi1453 jsSi1517 I; jsTi1493 jsSi1551 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1551 [LoxP::mec-4p::QF::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
|
|
NM5276 |
C. elegans |
jsTi1453 jsSi1543 I; jsTi1493 jsSi1548 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1543 [LoxP::tetO 7X::(delta)mec-7p::(delta)mec-7p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1548 [LoxP::mec-4p::rtetR-L-QF::FRT3] IV. RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet ON mec-4p rtetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
|
|
NM5312 |
C. elegans |
jsTi1453 jsSi1517 I; jsTi1493 jsSi1554 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1517 [LoxP::QUAS 5X::(delta)pes-10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSi1554 [LoxP::mec-4p::QF2::FRT3] IV. RMCE derived single copy QUAS GFP-C1 reporter line on Chr I and RMCE derived single copy mec-4p QF2 driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
|
|
NM5317 |
C. elegans |
jsTi1453 jsSi1519 I; jsTi1493 jsSi1560 IV. Show Description
jsTi1453 [LoxP::rpl-28p::FRT::GFP::his-58::FRT3] I. jsSi1519 [LoxP::tetO 7X:: (delta)pes10p::GFP-C1::FRT3] I. jsTi1493 [LoxP::mex-5p::FLP:SL2::mNeonGreen::rpl-28p::FRT::GFP::his-58::FRT3] IV. jsSI1560 [LoxP::mec-4p::tetR-L-QF::FRT3] IV.RMCE derived single copy tetO GFP-C1 reporter line on Chr I and RMCE derived single copy tet OFF mec-4p tetR-L-QF driver on Chr IV. Reference: Nonet ML. Genetics. 2020.
|
|
NM5322 |
C. elegans |
jsSi1570 I; bqSi711 IV. Show Description
jsSi1570 [delta_mosL::loxP::rpl-28::FRT::GFP::his-58::FRT3::mosR] I. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chromosome I. Derivative of jsTi1453 lacking the left mos1 arm.
|
|
NM5402 |
C. elegans |
jsSi1579 II; bqSi711 IV. Show Description
jsSi1579 [loxP::rpl-28p::FRT::GFP::his-58 FRT3] II. bqSi711 [mex-5p::FLP::SL2::mNG + unc-119(+)] IV. Dual component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
|
|
NM5471 |
C. elegans |
jsSi1669 IV. Show Description
jsSi1669 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3 rpl-28p::FRT::GFP::his-58::FRT3] IV. Single component RMCE landing site on Chr IV adjacent to the site of the commonly used ttTi10882 MosSCi insertion site.
|
|
NM5500 |
C. elegans |
jsSi1691 II. Show Description
jsSi1691 [loxP::mex-5p::FLP::D5::sl2::mNG::glh-2::3' rpl-28p::FRT::GFP::his-58::FRT3] II. Single component RMCE landing site on Chr II adjacent to the site of the commonly used ttTi5605 MosSCi insertion site.
|
|
NM5548 |
C. elegans |
jsSi1726 II. Show Description
jsSi1726 [loxP myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] II. Single component rapid RMCE landing site on Chromosome II adjacent to ttTi5605. Created from jsSi1579 (and jsSi1706) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
|
|
NM5549 |
C. elegans |
jsSi1727 I. Show Description
jsSi1727 [mosL::loxP::myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3::mosR] I. Single component rapid RMCE landing site on Chromosome I at jsTi1453. Created from jsTi1453 (and jsSi1710) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
|
|
NM5738 |
C. elegans |
jsSi1815 V. Show Description
jsSi1815 [loxP::mex-5p::FLP::sl2::mNeonGreen + rpl-28p::FRT::GFP::his-58 3' FRT3] V. Single component RMCE landing site on Chromosome V adjacent to oxTi365. Created using CRISPR/cas9 with SEC selection and heat shock excision. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
|
|
NM5753 |
C. elegans |
jsSi1837 IV. Show Description
jsSi1837 [loxP::mec-4Sp::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP D5::glh-2 3' FRT3] IV. Single component rapid RMCE landing site on Chromosome IV adjacent to cxTi10882. Created from jsSi1669 (and jsIs1824) by two rounds of RMCE. Unpublished as of 5-2-2022. See https://sites.wustl.edu/nonetlab/rrmce-landing-sites/ for sequence of insertion.
|
|
NM5879 |
C. elegans |
jsSi1900 II. Show Description
jsSi1900 [loxP::cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM5922 |
C. elegans |
jsSi1944 II. Show Description
jsSi1944 [loxP::mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM5934 |
C. elegans |
jsSi1962 I. Show Description
jsSi1962 [mosL::loxP::FRT + myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM5937 |
C. elegans |
jsSi1971 I. Show Description
jsSi1971 [mosL::loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3 mosR] I. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM5938 |
C. elegans |
jsSi1978 V. Show Description
jsSi1978 [loxP::FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM5943 |
C. elegans |
jsSi1986 IV. Show Description
jsSi1986 [loxP + myo-2p::FRT::nlsCyOFP::myo-2 3' + mex-5p::FLP::D5 glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM5944 |
C. elegans |
jsSi1987 V. Show Description
jsSi1987 [loxP + mec-4Sp::FRT::nls::cyOFP::myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM5945 |
C. elegans |
jsSi1988 IV. Show Description
jsSi1988 [loxP + cup-4p::FRT::cyOFP::tbb-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM5946 |
C. elegans |
jsSi1985 V. Show Description
jsSi1985 [loxP + myo-2p::FRT::nls::CyOFP myo-2 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM5953 |
C. elegans |
jsSi1949 II; him-8(e1489) IV. Show Description
jsSi1949 [loxP + myo-2p::FRT::nls::mNG myo-2 3' + <{rps-0p HygR unc-54 3'} ori <{Amp} <{mex-5p nls-Cre tbb-2 3'} + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM5970 |
C. elegans |
jsSi1973 I; him-8(e1489) IV. Show Description
jsSi1973 [mosL + loxP + myo-2p::FRT::nls::mNG::myo-2 3' + <{rps-0p::HygR::unc-54 3'} + ori <{Amp} <{mex-5p::nls::Cre::tbb-2 3'} + FRT3 + mosR] I. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM5989 |
C. elegans |
jsSi1963 IV. Show Description
jsSi1963 [loxP + FRT::myo-2p::nls::CyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM6007 |
C. elegans |
jsSi1901 II. Show Description
jsSi1901 [loxP + FRT + myo-2p::nls::cyOFP::let-858 3' + mex-5p::FLP::D5::glh-2 3' + FRT3] II. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM6024 |
C. elegans |
jsSi2029 IV. Show Description
jsSi2029 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + mex-5p::nls::Cre::glh-2 3' + FRT3] IV. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM6037 |
C. elegans |
jsSi2049 V. Show Description
jsSi2049 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} mex-5p::nls::Cre::glh-2 3' + FRT3] V. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
NM6168 |
C. elegans |
jsSi2027 II; him-8(e1489) IV. Show Description
jsSi2027 [loxP::myo-2p::FRT::Scarlet 2x::tbb-2 3' + rps-0p::hygR::unc-54 3' + ori <{Amp} + mex-5p::nls::Cre::glh-2 3' + FRT3] II. Him. Reference: Nonet ML. Rapid generation of C. elegans single copy transgenes combining RMCE and drug selection. bioRxiv 2023.03.05.531207; doi: https://doi.org/10.1101/2023.03.05.531207
|
|
OD2174 |
C. elegans |
unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V). Show Description
CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
|
|
OD2359 |
C. elegans |
fzy-1(lt20::loxP)/mIn1[mIs14 dpy-10(e128)] II. Show Description
CRISPR/Cas9 engineered deletion of fzy-1 in which the fzy-1 coding sequence was replaced by LoxP. Homozygous lethal deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are wild-type with relatively dim pharyngeal GFP signal, and segregate wild-type dim GFP (heterozygotes), Dpy bright GFP (mIn1 homozygotes), and non-GFP fzy-1 homozygotes (larval arrest). Pick wild-type with dim GFP and check for correct segregation of progeny to maintain. gRNA sequence: Ggacgcacgcccggtagtgc Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
|
|
OD2425 |
C. elegans |
plk-1(lt18[plk-1::sGFP]::loxp) III. Show Description
GFP inserted at the C terminus of plk-1 followed by LoxP generated by Cre-mediated excision of unc-119(+) cassette. Reference: Martino L. et al. Dev Cell. 2017 Oct. 23; 43(2):157-171.
|
|
OD2906 |
C. elegans |
mdf-1(lt39[mNG::tev::loxP::3xFlag::mdf-1]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous mdf-1 locus using CRISPR/Cas9 engineering. gRNA sequence: tgattgcattaaacatatt Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
|
|
OD2909 |
C. elegans |
san-1(lt42[gfp::tev::loxP::3xFlag::san-1]) I. Show Description
GFP tag inserted at 5' end of endogenous sep-1 locus using CRISPR/Cas9 engineering. gRNA sequence: taaaataatatgtataaac
|
|
OD3913 |
C. elegans |
cyb-1(lt125[cyb-1::LAP::mNG::loxP::3xFlag]) IV. Show Description
mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
|
|
OD4087 |
C. elegans |
cyb-3(lt135[mNG::tev::loxP::3xFlag::cyb-3]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
|
|
OD4376 |
C. elegans |
mdf-1(lt167[mScarlet::tev::loxP::3xFlag::mdf-1])V. Show Description
CRISPR/Cas9 engineered. Tagged MDF-1 at its endogenous locus with mScarlet. gRNA sequence: tgattgcattaaacatatt Reference: Lara-Gonzalez P, et al. Science. 2021 Jan 1;371(6524):64-67. doi: 10.1126/science.abc1424. PMID: 33384372.
|
|
OH15876 |
C. elegans |
pha-4(ot946[pha-4::3xGAS::GFP::TEV::LoxP::3xFLAG]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous pha-4 locus by CRISPR. Allele obtained using Cas9-sgRNA ribonucleoprotein complex, following Dokshin et al, 2018 method. Please contact Oliver Hobert prior to publishing work using this strain.
|
|
OH17918 |
C. elegans |
lep-5(ot1215[lep-5p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the lep-5 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. Males exhibit typical leptoderan tails.
|
|
OH17921 |
C. elegans |
linc-3(ot1217[linc-3p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) V. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-3 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers.
|
|
OH17923 |
C. elegans |
linc-19(ot1219[linc-19p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) III. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-19 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in dauers.
|
|
OH17929 |
C. elegans |
linc-23(ot1225[linc-23p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad.
|
|
OH17932 |
C. elegans |
linc-26(ot1227[linc-26p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-23 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad and extremely dim expression in hermaphrodite spermatheca.
|
|
OH17935 |
C. elegans |
linc-36(ot1229[linc-36p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-36 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the sperm of both hermaphrodites and males.
|
|
OH17938 |
C. elegans |
linc-41(ot1231[linc-41p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) IV. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-41 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad, spermatheca of hermaphrodites, as well as several other tissues in the head.
|
|
OH17942 |
C. elegans |
tts-1(ot1234[tts-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) X. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the tts-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in several tissues including the pharynx but is significantly upregulated in a stress-dependent manner in a variety of tissues.
|
|
OH17945 |
C. elegans |
puf-9(ot1236[puf-9::GFP::loxP::3xFLAG]) X. Show Description
SEC cassette was used to generate a C-terminal GFP tag of puf-9. Expression is cytoplasmic and pan-somatic throughout larval development into adults.
|
|
OH18019 |
C. elegans |
linc-1(ot1249[linc-1p::SL1::tbb-2 5'UTR::GFP::H2B::loxP::sqt-1(d)::hygR::loxP::3xFLAG::tbb-2 3'UTR]) I. Show Description
The Null Transcriptional Reporter (NuTR) cassette was used to remove the linc-1 locus resulting in a null allele and transcriptional reporter driving expression of GFP. The cassette contains the dominant sqt-1(e1350) allele that results in roller animals. Expression of Cre (via crossing into a strain expressing a germline Cre or by injection of a Cre transgene) will result in removal of the selectable markers and result in non-roller animals. Pick Rollers to retain full transgene cassette. GFP expression is seen in the male somatic gonad.
|
|
PHX2880 |
C. elegans |
ceh-16(syb2709[loxP] syb2880[ceh-16::loxP::GFP]) III. Show Description
GFP tag inserted at the C-terminus of the endogenous ceh-16 locus by CRISPR. Allele generated by SUNY Biotech. Reference: Reilly MB, et al. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
PHX2934 |
C. elegans |
ceh-37(syb2933[loxP]) ceh-36(syb2934[ceh36::loxP::GFP]) X. Show Description
CRISPR/Cas9 engineered tagged endogenous locus. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|