Homozygous viable. Deletion of 2231 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCTACTGTCTGCTGATGTTCCGTTTGTA; Right flanking sequence: CTCACCAGGAATAGGAGAAATGAAAATAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5005 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2246 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ACTGCGATCTTGCTTCAAGCTATGCGAATG. Right flanking sequence: TCCGAGACTCTGCACACGCCGGTGATGATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5006 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3229 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GTGGTGCCATTGGTGGTGGTGGAGCCATTG; Right flanking sequence: TTTGGCTGCATGTTGTTTAGTGGCATGCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 697 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TATTATCAACGAAAAATCTTCACAGTTCCA; Right flanking sequence: AGAACTAAGATAAGTGCTATTCCATCAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion balanced by mIn1. Deletion of 772 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous mIn1 is non-GFP fertile Dpy-10. Left flanking sequence: TTCTCTTCTATATATATATATTCTCCGTTT; Right flanking sequence: TAATTTGGTATCCACTGTATTTGTTGAAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion balanced by tmC9. Deletion of 4391 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC9 is non-GFP Mec-3 Unc-31. Left flanking sequence: GTGCCAATTTTCCAATTACTTTTGCCGTTT; Right flanking sequence: CATGGAAGTGCACCACAATGATCCAAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion balanced by tmC3. Deletion of 2147 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous tmC3 carries myo-2p::mCherry and is Unc-23 Lon-3. Left flanking sequence: GAAAATAGGCAAAAATATTAAACCGTGAAG; Right flanking sequence: GGAAGTGTCATGTTATGATTGACTCCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 7739 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AATAGAGAAGGATAATTTTTTAGGCCTCGG; Right flanking sequence: GAAGGATATTATCTAAGCAAACACTGAAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 890 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GGTGCACAAACAGTCAGCCCGTTCCCAAAT. Right flanking sequence: GACGGAGTGCTTCATATGCTTCAGGAGACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1640 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTGCCATCTCAATATCTTTTTTTGCCACCG; Right flanking sequence: GAGTGATGTTTTCTTCCATTTCCACTTACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5031 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2935 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TCTCGTATTATGGCGGAACGGAAACCTCAG; Right flanking sequence: GCAATGAATGAGCTAGTGGCTGTTGTAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5007 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 5263 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGGAACATACTTCTTCGTCGATATGGAGTA; Right flanking sequence: ATGTACTACATGTTTTCGATGTGTAGATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1198 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CGCAGATCGAGTAGAACTTGAAAGAGCATG. Right flanking sequence: AGCACTTCAAAAGTTTCGAGTGTTTTATTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5018 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 3877 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAAATATTCGAACTTCTCGATGGTCCACCA; Right flanking sequence: ATAGAAAACAGGATTTGATGTTGAAAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 7706 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CGATAAAAAGGTGAGAAAATAGAGAAACGT; Right flanking sequence: TGGTGCAGGTGATGAATAATTTTCTCCCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1618 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CAGGTTTTTGTGGATCATATCGTACGGATT. Right flanking sequence: ATGAAATCCGTGATAAACTCGAAATTCGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 9122 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CAAACACCGCCACGACAAATTTAACAGAAT. Right flanking sequence: CTTGGGAACAATCTCCAGCGCACAATTGCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5032 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1853 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GACCAAACCGTCAGACATGCTGCGTCTCCT; Right flanking sequence: AACTGGCAAGAAATGGTTCCGCATTGTGAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 562 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AAAATAATCAATAAAGTATCGATTTTTCCG; Right flanking sequence: TGAAAAAACATTAAAAATAGCGGTTATTCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5019 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2626 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTTTACCTATTGCTTTTGCTCTGTAGTA; Right flanking sequence: GACGGTGTTGCTGCTGGGCTGCTGCTCAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 909 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GACGAAAAATCCAAATACATAACGAGACCC; Right flanking sequence: GGACTCAATTTCGACTATTTCCTGTTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5020 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2871 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. [NOTE: VC4403 exhibits weak red fluorescence. The cause of this fluorescence is unknown, but gk5481 is a clean deletion/insertion confirmed by PCR.] Left flanking sequence: TTGCTTTCAGGCAATCGTCACGCTCGTTGA; Right flanking sequence: GGCGGGAGATCTGCAAAAATCGATAATCTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5033 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 2468 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTTTAAACACGTTTTTATTCGAAACCTGAT. Right flanking sequence: GCTGGAAATGGAAAATGACGAAAAAATATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4078 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TTCTAATCCCGCACCCACACGTAATGCAGA. Right flanking sequence: GGTGGTGGAGTTGCTTCTCAGTAAGGAATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1076 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGAGAAAATATTAATGTGGAGGTGGTTACT; Right flanking sequence: GATGGGTTTTATAGAAAAATTATCGATTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 4641 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: ATGAATATTAGGATTTTCTCCGTTCCAGTG. Right flanking sequence: GCATGCCAACCTGATTATCGACAAGTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2082 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AATTCAAAAATTCCAGCAATTCAACCGTAC. Right flanking sequence: AGCCGGTGCTATTGTGGTTTCTATGTACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2375 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: CCGCTGTGAAAATCGTTTTACAGGCATCCA. Right flanking sequence: ATTTGTCCATCATGCAGTTCGTTCAAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2081 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CCACTTCTGAATGTTTTAAACTCGACATGC; Right flanking sequence: AATCTCTCCTCTCGTGTTTTGAAAATTTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1076 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTTTAGAGAGTTTTTTCTCGAATTTACCT; Right flanking sequence: CGGCAGTTTGCGAATAAATAATTGTGAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1162 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GGTAGGCAGGCGAATTTTTATGTGCCTCCT; Right flanking sequence: CTGTTTTTGCATGCGAAATAGTTATTTTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2573 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GAAGCGTATGAACTGCTGGTAGGGGTTTTA; Right flanking sequence: TGGCCATATTTTTCCTGCAGTGCCGCACGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1257 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCGAACAAAAGTCTCAAAAATGCTTTCACC; Right flanking sequence: ACCGTATCAAATACGACATCAACACCATCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1512 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGTTCGGTTGTTGGTGAAGCTGCTGAGCCA; Right flanking sequence: GATGAGAGCGAGTAAGCTCCGTTGGAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 751 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CCAGATCAAATGTTTGGAGGATCTGCACCA; Right flanking sequence: CCATCAGCTTCTGCAGCTGCTTCTTCATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 433 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: GATCGATGCGTTTTCAGATTCATCATTGAC; Right flanking sequence: ATTTCTAGCTTGAAATGGAGGAAAGTACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5021 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 735 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TAAAACCGCTCCAGCGCGGTACATTTCTGT; Right flanking sequence: GTAAAATAGAGATTTTCCATGGAGCGCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1407 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: GAAGAACTTGATAGACTAGTTACTAATATC. Right flanking sequence: ATTGGGTACTGCCTGGGAAATTCCGGCTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1335 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGCCGTTGCGAAAGCGCTTCATACAGTCCA; Right flanking sequence: TTTGGATTTTCTAGCAGGCCCCGTAGTCCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1557 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCACTTCGGACTGTTATATGTCCTGGTTCA; Right flanking sequence: GACATCGACCATATCAGTCGTATGTCACCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3868 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTTGACGCTCAAGAAATCATGGACCTTGA; Right flanking sequence: CGTGGCCAATCCTCAAAATGCCCTACGAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1803 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TGGCCAAGATATTTTACGACATCACCACCC; Right flanking sequence: GCAGTTTAGTGCTCCACGAATTAAATTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5034 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1322 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: GAGGTCGCAGAAGAACATTGACCCCAGCTC; Right flanking sequence: GAAGAGATAAAACGAAAGCTAAGATTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1067 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: ATGGCAACATAGTCGTCAGCGAGCTCCATG; Right flanking sequence: GAAGCTTCTCGTTTAGTTTTCCCACAAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3366 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTTATACCGGATTCAAAATTTGTGCCCTCT. Right flanking sequence: ATATCACATTGAGAGCTTGTGAACATATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5035 for balanced version of this strain.] Apparent homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 957 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: TAACTACTTCTTTCGTTCATAGGTCCATTT. Right flanking sequence: CGAGGACATGGCTGGCTGAAAATAATTTTA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 325 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCGTCAAGCTGGAGAAGGAAACGGACAATG; Right flanking sequence: GGAGAAAACGGAAACAACGGTGAGCCACAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3203 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTTGGCAAAGTACAAGTAACATGCTCACCG; Right flanking sequence: AAAAATACCTCATATGATGATACAGTTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

[NOTE: Please see RG5036 for balanced version of this strain.] Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1052 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: CTATTTTCAGCGTCTCACAGCATTCCTACA; Right flanking sequence: GAATTTCTGGAGTCGGAGTTGAATTCAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous lethal or sterile deletion as unbalanced heterozygote. Deletion of 1132 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain. Left flanking sequence: AGACACGCACGAAAATCACGCCAGCACGTT; Right flanking sequence: GTTGGAGTCGTCTCTAAATAATTTTCTTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.